ID: 1026977769

View in Genome Browser
Species Human (GRCh38)
Location 7:74508809-74508831
Sequence TCTCCTAGCAGGTGACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026977753_1026977769 24 Left 1026977753 7:74508762-74508784 CCCCTCTTGCCATTCCCACTTTG 0: 1
1: 0
2: 0
3: 30
4: 326
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977761_1026977769 0 Left 1026977761 7:74508786-74508808 CCCTGGGATGAACCACATGCCTA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977754_1026977769 23 Left 1026977754 7:74508763-74508785 CCCTCTTGCCATTCCCACTTTGT 0: 1
1: 0
2: 2
3: 31
4: 373
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977760_1026977769 9 Left 1026977760 7:74508777-74508799 CCACTTTGTCCCTGGGATGAACC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977758_1026977769 15 Left 1026977758 7:74508771-74508793 CCATTCCCACTTTGTCCCTGGGA 0: 1
1: 0
2: 3
3: 18
4: 381
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977762_1026977769 -1 Left 1026977762 7:74508787-74508809 CCTGGGATGAACCACATGCCTAT 0: 1
1: 0
2: 2
3: 13
4: 112
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977755_1026977769 22 Left 1026977755 7:74508764-74508786 CCTCTTGCCATTCCCACTTTGTC 0: 1
1: 0
2: 2
3: 37
4: 302
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977752_1026977769 30 Left 1026977752 7:74508756-74508778 CCTTCACCCCTCTTGCCATTCCC 0: 1
1: 0
2: 5
3: 48
4: 528
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1026977759_1026977769 10 Left 1026977759 7:74508776-74508798 CCCACTTTGTCCCTGGGATGAAC 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026977769 Original CRISPR TCTCCTAGCAGGTGACCTGG GGG Intronic
900526012 1:3129016-3129038 TCCCCTAGCAGGAAACCAGGAGG + Intronic
900625875 1:3608330-3608352 TTTCACAGCACGTGACCTGGAGG - Intronic
900710605 1:4111068-4111090 TCTCAAAGCAGGTGACCAGGAGG + Intergenic
902199993 1:14826249-14826271 TTTCCCAGCATGTGACCAGGAGG + Intronic
902447122 1:16474465-16474487 TCTCCCAGCAGCTGAGCTGGCGG - Intergenic
902466983 1:16624444-16624466 TCTCCTGGCAGCTGAGCAGGCGG - Intergenic
904095496 1:27973679-27973701 TCTCCTAGCTGGTGAACTGTGGG - Exonic
904341365 1:29837029-29837051 TCTCAGAGCAGGTGACATTGAGG - Intergenic
907275444 1:53314357-53314379 TCCCCTAGCATGGGGCCTGGTGG - Intronic
907366282 1:53963389-53963411 TTTGGTAGCAGGTGACATGGTGG + Intronic
907544017 1:55243603-55243625 TCTCTGAGGAGGTGACCTGGAGG - Intergenic
908038354 1:60080699-60080721 TCCCCCAGCATGTGGCCTGGGGG - Intergenic
909566063 1:77054732-77054754 TTTCCCATCAGGTGTCCTGGAGG + Intronic
915268442 1:154734974-154734996 TCCAGTAGCAGGTGACCAGGGGG + Intronic
915838933 1:159200151-159200173 TCTTGCAGCAGGAGACCTGGAGG - Intronic
917995269 1:180431833-180431855 ACTCCTAGAAGGTAACATGGCGG + Intronic
920387347 1:205578406-205578428 TCTCCTAACAGCTGGCCTTGAGG + Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
1063838826 10:10047383-10047405 TCTTCTAGAAGATGACCTGAAGG + Intergenic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1067060013 10:43073459-43073481 CCTCCTCGCAGCTGCCCTGGAGG + Intergenic
1067079617 10:43205714-43205736 CCAGCTAGCAGGTGGCCTGGGGG - Intronic
1070604555 10:77889613-77889635 CAGCCTAGCAGGTGACCTGCTGG - Intronic
1070801503 10:79246879-79246901 TCTCCTGCCATGTGACCTTGGGG - Intronic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1073027036 10:100495524-100495546 TCTCTTAGCTGCTGAACTGGTGG + Exonic
1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG + Exonic
1077167910 11:1152068-1152090 GCCCCTAGGAGGTGACCTGCAGG - Intergenic
1079802414 11:24887047-24887069 TATACTAGCAGGTGCCCTGTTGG + Intronic
1081277825 11:41171890-41171912 TTTCCCAGCAGCTGGCCTGGTGG - Intronic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083708279 11:64531458-64531480 TCTCTTAGGAAGTGACATGGCGG + Intergenic
1084098880 11:66932263-66932285 TCTTCTAGCAGGTTACCAAGCGG - Intronic
1084719164 11:70893029-70893051 TCCCCTAGAAGCTGACCTTGAGG - Intronic
1091128164 11:133120539-133120561 TCAGCTAGCATGTGCCCTGGAGG - Intronic
1092061370 12:5553660-5553682 GCTCCTAGTAGGTGGCATGGTGG + Intronic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1101765959 12:107699602-107699624 TGAGCTGGCAGGTGACCTGGAGG - Intronic
1103209379 12:119155361-119155383 TCTCCCTGGAGATGACCTGGAGG + Intronic
1104858578 12:131913187-131913209 TCCCCCTGCAGGTGACCTGGTGG + Exonic
1106433497 13:29704250-29704272 TCTCCTACCAGTAGTCCTGGAGG - Intergenic
1108671906 13:52698968-52698990 TTTTGAAGCAGGTGACCTGGAGG + Intronic
1113094398 13:106648508-106648530 ACTCCTAGAATGTGACCTGGAGG + Intergenic
1113292585 13:108922995-108923017 GCTCCTAGCATGTGACTGGGAGG - Intronic
1113651142 13:112035071-112035093 TCTCCTGGCAGATGCCCTGAGGG - Intergenic
1124077898 15:26462794-26462816 TATCCTATCTGGTGACCTTGAGG - Intergenic
1125591364 15:40856537-40856559 TCTCCTTGCAGTTAACTTGGGGG - Intronic
1127393964 15:58528822-58528844 TCTTCTGGCAGCTGACCTGGAGG + Intronic
1128519533 15:68366338-68366360 TTTCCCAGCAGGTAACCTTGTGG - Intronic
1128647084 15:69385638-69385660 TCACCTAGAATGGGACCTGGAGG - Intronic
1129783818 15:78294246-78294268 TCTCTAAGTAGGTGACATGGAGG - Intronic
1130321339 15:82844966-82844988 GCTCCTGCCAGGTGCCCTGGGGG + Intronic
1131416880 15:92267610-92267632 CCTCCTGGGAGGTGAGCTGGAGG - Intergenic
1131602166 15:93860620-93860642 TCTCCCAACATCTGACCTGGAGG + Intergenic
1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG + Intronic
1136605325 16:31329884-31329906 CCTCGGAGAAGGTGACCTGGGGG - Exonic
1137545047 16:49396856-49396878 TCTACCAGCAGGTGAGCTGCTGG - Intronic
1138352149 16:56351829-56351851 TCTTCTAGAGGGTGACCAGGAGG - Intronic
1139682256 16:68574128-68574150 TCTCCTATCATGTGACCTACTGG + Intronic
1140597908 16:76437715-76437737 TCTTCTATCTGGTTACCTGGAGG - Intronic
1142162329 16:88564514-88564536 TCTCCTAGCAGGTGCTCTAAGGG + Intergenic
1142198651 16:88750729-88750751 TCTCCTCGCAGGGGACCTGAGGG + Intronic
1143112109 17:4558647-4558669 TCTACTGGCGGGAGACCTGGGGG - Exonic
1143263307 17:5616634-5616656 TCCCTTAGCAGTTAACCTGGAGG + Intronic
1143369451 17:6429366-6429388 TCTCTGTGCTGGTGACCTGGAGG - Intronic
1146984720 17:37204395-37204417 TCTTCTAGCTGGTGACCTAGGGG + Intronic
1147299316 17:39511569-39511591 TCTCCTAGCAGTAGTTCTGGAGG - Exonic
1147961058 17:44167883-44167905 TCTCAGAGCAGGTGACCTTAGGG + Intergenic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148844618 17:50522091-50522113 TCTCCCAGCAGGTGTGGTGGAGG - Intronic
1150587145 17:66529324-66529346 TCCACCAGCAGCTGACCTGGTGG + Intronic
1151770817 17:76159467-76159489 TCTCCAAGCACGTGAAGTGGAGG + Exonic
1151882978 17:76905938-76905960 TCTCCTGGCCGGTGCCCCGGGGG + Intronic
1152385499 17:79971852-79971874 TCTCGGAGCAGGTGGCATGGGGG + Intronic
1154111018 18:11568426-11568448 TGTCAAAGCAGATGACCTGGTGG - Intergenic
1155199429 18:23503894-23503916 TGTCCTCGCAGGTGACCTCGGGG + Intronic
1156112068 18:33740238-33740260 TATCCCATCAGGTGACTTGGAGG - Exonic
1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG + Intergenic
1160964696 19:1741953-1741975 TCTCCCAGCTGGTGTCCTTGGGG - Intergenic
1161799937 19:6412006-6412028 TTTCCTACCAGGTAACCTGGGGG + Intergenic
1163403137 19:17106546-17106568 CCTCCCAGCAGGTGGCCAGGGGG + Intronic
1163691421 19:18740593-18740615 GCTCCTGGGAGGTGACCTGCAGG - Intronic
1165321978 19:35091110-35091132 CCTCCTACCAGGTGAGCTGGGGG + Intergenic
1165357031 19:35310679-35310701 TCTCCAAAAAGGGGACCTGGTGG + Intronic
1166702702 19:44891399-44891421 TCCCCTAGCAGGCGACCATGGGG + Exonic
1167169211 19:47820021-47820043 TCTCCTAGCAGGGGGTTTGGGGG + Intronic
1167301140 19:48678446-48678468 TCTGCAGGCTGGTGACCTGGAGG - Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
926743001 2:16127607-16127629 TCTCCCAGCATGTGAACTTGTGG - Intergenic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
931764012 2:65438615-65438637 TCTCCCACCAGGGGAGCTGGAGG + Intergenic
937497638 2:122440233-122440255 TATCCTAGCAGGTGTTTTGGTGG + Intergenic
937779367 2:125819724-125819746 TCTCCTAGTAAGTGAGCTGGTGG + Intergenic
938016853 2:127874395-127874417 TCTCCTGGTCTGTGACCTGGAGG - Intronic
944131475 2:196352217-196352239 CCTCTTAGCAGGTGGCCTGGTGG - Intronic
944951494 2:204755292-204755314 TTTCCTAACAGGTGACTAGGGGG - Intronic
945738458 2:213630993-213631015 ACTCTTAGGAGGTGCCCTGGAGG + Intronic
945967583 2:216205310-216205332 ATTCCCAGCAGGTTACCTGGAGG + Exonic
947013359 2:225590304-225590326 TCTCCCAGGATGTGACCTTGGGG + Intronic
947352530 2:229261377-229261399 TTTCCTAGTAAGTGAGCTGGAGG - Intronic
947760419 2:232599971-232599993 TCCCCTAACAGGTGACCTTCCGG - Intergenic
948591572 2:239053962-239053984 TCTGGGAGCAGGTGAGCTGGGGG + Intronic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
1169269357 20:4187388-4187410 TCTTCCAGCAGGGGACCTGAGGG + Exonic
1170566636 20:17611538-17611560 GCTCCCAGCAGGTGGCCTGAAGG + Intergenic
1171074158 20:22105053-22105075 TCTCCCAGAAGGTGAGGTGGAGG + Intergenic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1174044067 20:47720854-47720876 TAACCTAGCAGGGGAGCTGGAGG + Intronic
1175368289 20:58470224-58470246 TGTGATAGCAAGTGACCTGGAGG - Intronic
1179709802 21:43206786-43206808 TCTCCTACAAGCTGACCTAGTGG + Intergenic
1179891580 21:44338475-44338497 ACTCCTAGCAGGTGACAGGAAGG - Intronic
1180008678 21:45035210-45035232 TCCACAGGCAGGTGACCTGGAGG + Intergenic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1181237498 22:21456514-21456536 GCTCCTTTCAGCTGACCTGGAGG - Intergenic
1182584191 22:31334363-31334385 TTTCACAGCAGGTGTCCTGGTGG + Intronic
1183279750 22:36925668-36925690 TCTCTAAGGAGGTGACCTGGGGG - Intronic
1184737677 22:46408956-46408978 CCACCTAGCAGGTGCCTTGGTGG + Intronic
950027896 3:9833267-9833289 TTTCCTAGAAGCTGACCTGTGGG - Intronic
950678943 3:14571646-14571668 TCACCTGGCAGGGGAGCTGGAGG + Intergenic
952363840 3:32657532-32657554 TCTGCTAGCATGTGAACTTGAGG + Intergenic
954035323 3:47848173-47848195 TCTCCAGGCAGGACACCTGGAGG - Exonic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
955337231 3:58096840-58096862 TCTCCTTGGAGGTGCTCTGGAGG + Intronic
958531057 3:95330494-95330516 TCTACTCACAGGTGACCTTGTGG - Intergenic
960265422 3:115615706-115615728 ACTCCTAGCACCTGGCCTGGTGG - Intergenic
961583716 3:127904460-127904482 TCTCTGAGGAGGTGACCTGAAGG - Intergenic
964049792 3:152376733-152376755 TCTCCTAGCAGATGAGCTGAGGG + Intronic
964371304 3:156003541-156003563 TCTCCCAGCAGGAGGCATGGGGG + Intergenic
968578584 4:1379257-1379279 TGTCCTAGAAGGAGGCCTGGTGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
971487263 4:27172791-27172813 CCTCCTGGCAGGTGATGTGGTGG + Intergenic
971719157 4:30222714-30222736 TTTCCTAGAATGTGACCAGGGGG + Intergenic
985260041 4:188106593-188106615 TCTCCTGGCCGGTCACCTGGAGG - Intronic
985670345 5:1203582-1203604 GAGTCTAGCAGGTGACCTGGTGG - Intronic
985860118 5:2464272-2464294 CCTCCATGCAGGTGGCCTGGCGG + Intergenic
988298650 5:29394710-29394732 TGTCTTAGGAGGTGACCTGAGGG - Intergenic
994682794 5:102910171-102910193 TCTCTAAGAACGTGACCTGGGGG - Intronic
996447931 5:123579207-123579229 TTTCCTAACAGCTGACCTGACGG + Intronic
999133883 5:149304729-149304751 TCTCCTGGGAGGTGAACGGGGGG - Intronic
1001246901 5:170111609-170111631 TCTCCCAGCAGCTTCCCTGGCGG + Intergenic
1003306225 6:4932011-4932033 TCTCCCAGCAGTTTTCCTGGTGG - Intronic
1005756051 6:28925773-28925795 TCTGGAGGCAGGTGACCTGGGGG + Intergenic
1016019117 6:139217164-139217186 TCTCCTAGCAGCAGACCTAATGG + Intergenic
1016464253 6:144309914-144309936 TCTTCTAGCAGATAACCTTGTGG + Intronic
1019212282 6:170416468-170416490 GCTCATAGAAGATGACCTGGTGG + Intergenic
1019747670 7:2709633-2709655 GCTCGTGGCACGTGACCTGGGGG - Exonic
1020049583 7:5072767-5072789 TCCCGCAGCAGGTGCCCTGGGGG - Intronic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1024530002 7:50383716-50383738 TCTCTAAGCCGGTGCCCTGGGGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1029616918 7:101664961-101664983 TTTCCTAGGAGGTGTCCAGGGGG - Intergenic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1037968385 8:23152039-23152061 TTTACTAGCAGTAGACCTGGTGG + Intronic
1038266024 8:26040604-26040626 TCACCAAGCAGGTGAGCCGGAGG - Exonic
1040395930 8:47000124-47000146 AGTCCTGGCAGGTAACCTGGCGG - Intergenic
1041215309 8:55594720-55594742 TCTCCAAACAGGTGCCATGGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045690996 8:104759575-104759597 TCTCCTGTCAGGAGACCTGCAGG - Intronic
1048184802 8:132229875-132229897 ACTCCTATCAGGAGACGTGGTGG + Intronic
1051421766 9:16896134-16896156 TCTCCAAGCTGGTTACCTTGAGG + Intergenic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1055950168 9:81722994-81723016 GCTCCTAGGATGGGACCTGGTGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1058197738 9:101999619-101999641 TCTCCATGCAGGTGACCAGCTGG - Intergenic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1062555616 9:137112367-137112389 CCTCCAAGCAGGTAGCCTGGAGG - Intronic
1185724481 X:2408414-2408436 CCTCCTGGCATGTGCCCTGGAGG + Intronic
1196475567 X:116080440-116080462 TTTCCAAGCAAGTCACCTGGAGG + Intergenic
1198312357 X:135435214-135435236 TCTCCCAGCAGCTGAGCGGGCGG + Intergenic
1200149620 X:153944796-153944818 GCTCCCAGCAGGGGCCCTGGAGG - Intergenic