ID: 1026979047

View in Genome Browser
Species Human (GRCh38)
Location 7:74515987-74516009
Sequence CTGTGCCATGCTCAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026979047_1026979062 27 Left 1026979047 7:74515987-74516009 CCATCACCCTGAGCATGGCACAG 0: 1
1: 0
2: 0
3: 23
4: 266
Right 1026979062 7:74516037-74516059 CCACACCTTCTTCTCCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026979047 Original CRISPR CTGTGCCATGCTCAGGGTGA TGG (reversed) Intronic
900342822 1:2196898-2196920 CTGTGCCGTGCTGGGGGTGGTGG + Intronic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
901208051 1:7508586-7508608 CTGTGCCTGGCTCAGGGCAAAGG + Intronic
901644703 1:10710179-10710201 CTGAGCCAGCCTCAGGGTGGAGG - Intronic
902658170 1:17883728-17883750 GTGTGCCAGGCCCAGTGTGAAGG - Intergenic
903877767 1:26487310-26487332 CTCTGCCATCCTCAGTGTGTTGG - Intergenic
905479485 1:38251318-38251340 ATGTGCCAGGCTCTGTGTGAGGG + Intergenic
905964631 1:42081500-42081522 GGGTGGCATGCTCAGGGGGAGGG + Intergenic
906911860 1:49961033-49961055 CTGTGCCATGCTGAGGAAGATGG + Intronic
907087275 1:51687185-51687207 TTGTGCCATCCTCAGTGTGTGGG - Intronic
907154901 1:52324639-52324661 CTGTAACATGCACAGGATGATGG + Intronic
908023791 1:59926731-59926753 CTGAGCCATGCTCGCGGCGATGG - Exonic
908257307 1:62313687-62313709 CTGGGGCCTGCTGAGGGTGAGGG + Intronic
908530914 1:65033129-65033151 CTCTGCCATCCCCAGGGTGGGGG - Intergenic
909771109 1:79422782-79422804 CAGAGCCATGTTCAGGGTGAGGG - Intergenic
911051421 1:93674813-93674835 CTGGGCGATGCTCAGCGAGAGGG + Exonic
912457354 1:109806959-109806981 CTGGGCCAGGCTGGGGGTGAGGG - Intergenic
912480023 1:109976162-109976184 TTGTGCCATCCCCAGGGTGGAGG - Intergenic
912752498 1:112297300-112297322 TTGTGCCATGACCAGGGTGCAGG - Intergenic
915141483 1:153771129-153771151 CTCTGCTCTGCACAGGGTGAGGG - Intronic
915359846 1:155279263-155279285 CTGTGCCATTCTCTGAATGAGGG + Intronic
916754221 1:167753341-167753363 GTGTGCCATGCTGAGAATGATGG + Intronic
917504574 1:175616230-175616252 CAGGGCCATGAGCAGGGTGAAGG - Intronic
919841117 1:201610079-201610101 CTCTGCTCTACTCAGGGTGAAGG + Intergenic
1064703010 10:18041130-18041152 CTCTGACCTTCTCAGGGTGAGGG + Intronic
1065203437 10:23335967-23335989 CTCTTCCCTTCTCAGGGTGAAGG + Intronic
1065903728 10:30230002-30230024 AGGTGCCAGGCTCTGGGTGATGG + Intergenic
1066367770 10:34793325-34793347 TTCTGCCATGATCAGGGAGAGGG + Intronic
1067102623 10:43343926-43343948 CAGTGCCCTGCTCACGGTGCTGG - Intergenic
1067763997 10:49071558-49071580 CAGTGCCAGGCTTGGGGTGAGGG + Intronic
1068004071 10:51371916-51371938 CTATGCCCAGCTCAGGGTGATGG + Intronic
1069794058 10:71041219-71041241 CTGAGCCATGCTCAGGGCAGAGG + Intergenic
1069897393 10:71688161-71688183 CTGGGCCAGGCTCAGGTTGCAGG + Intronic
1070099288 10:73369567-73369589 CTGTGCCTTTCTCTGGGTGTGGG - Intergenic
1070598279 10:77848057-77848079 CTGTCCCGTGCTCAGGCTGGAGG - Intronic
1070788071 10:79173886-79173908 CTGTGCCAGGGTCTGGCTGAGGG - Intronic
1070820977 10:79354125-79354147 CTGTGCCTTGGACATGGTGATGG + Exonic
1072521579 10:96234692-96234714 CTTTGCAATGCTCAAGATGACGG - Intronic
1072765272 10:98089896-98089918 CTGTGGCTTGGTCTGGGTGATGG - Intergenic
1073361798 10:102905335-102905357 CAGTGCAATGCTCCAGGTGAGGG + Intergenic
1073517611 10:104091298-104091320 CAGTGTCATTCTGAGGGTGAGGG + Intergenic
1075531196 10:123231443-123231465 CAGTGACATGGTCTGGGTGATGG + Intergenic
1076631257 10:131853483-131853505 CTGTCCCGTGAGCAGGGTGACGG + Intergenic
1077472739 11:2771892-2771914 CTGGGCCATTCTCAGGGTCCCGG - Intronic
1078064912 11:8072009-8072031 CTGTGCCTTCCTCAGGATGGAGG + Intronic
1078854720 11:15197722-15197744 CTGTGCCTTGCACAGGGGAAGGG - Intronic
1082005032 11:47414642-47414664 CTCTGCCATACTCAGGATGGGGG + Intronic
1084629944 11:70341514-70341536 CAGGGCCATGTTCAGGTTGATGG + Intronic
1085049928 11:73375247-73375269 CTGGGTCATGCTCAGGTTGTGGG - Intergenic
1085299587 11:75450353-75450375 CTGTGCCATGCTGAGGTGGCAGG - Intronic
1085456127 11:76666303-76666325 CTAGGCCATGCTCAGGGCCAGGG + Intronic
1086555194 11:88102044-88102066 CTGTGCCAGGCACAGAGTGAGGG + Intergenic
1088377457 11:109158428-109158450 CTTTGACATGATCAGGGTCATGG - Intergenic
1089136415 11:116252853-116252875 CTCTGCCATCCTAAGGGTGTTGG + Intergenic
1090241842 11:125189127-125189149 CTGCGCCATGGTCAGGAAGAGGG + Intronic
1090806160 11:130203609-130203631 CTTCCCCATGCTCAGTGTGAGGG + Intronic
1091267282 11:134281465-134281487 CTGTGCCCTGGTCAGGGGCAGGG + Intronic
1091788821 12:3259449-3259471 CTGTGCCAGGCACATGGTAAGGG - Intronic
1092119520 12:6034261-6034283 CTGTGCACTGCCCAGGGTGCTGG + Intronic
1092917773 12:13203650-13203672 CTGTGCCAGGCACAGAGTGGGGG - Intronic
1096403285 12:51324434-51324456 CTTTGCAGTGCTCAGCGTGATGG - Intronic
1098477805 12:70925755-70925777 CTGTGTGCTGCTCAGGATGATGG - Intergenic
1101150468 12:101878116-101878138 CTGTTCCATGCTCCGGGTACAGG - Intronic
1101168745 12:102065832-102065854 CATTGCCATGCCCAGGGAGAAGG - Intergenic
1101396964 12:104356849-104356871 CAGGGCCAGGCTTAGGGTGAGGG - Intergenic
1101737712 12:107475448-107475470 CTATGACATGCCCTGGGTGATGG - Intronic
1102185073 12:110941473-110941495 CTGGGACTTGCTCATGGTGAGGG + Intergenic
1102298448 12:111754788-111754810 CTGTGCTTTGCTCAGGGTCACGG - Intronic
1106234224 13:27848207-27848229 CTCTGCCATGGTCAGTGAGAGGG - Intergenic
1106486750 13:30179347-30179369 CAGGGCTATGCACAGGGTGAAGG - Intergenic
1106920745 13:34560859-34560881 CTGTGCCAGGCACAGGGATATGG + Intergenic
1109862471 13:68218244-68218266 CTGTGGCATCCTCCTGGTGAAGG - Intergenic
1113680246 13:112238770-112238792 CTGGCCCATGCTCAGTGTGCAGG - Intergenic
1113749119 13:112766419-112766441 CTGTGACAGCCTCTGGGTGAGGG - Intronic
1114255434 14:20997710-20997732 CTGTCCCATGCTCATGTTGATGG + Intergenic
1114955800 14:27817829-27817851 CTGTGCCATTTTCAGGGTTGTGG - Intergenic
1116950467 14:50874100-50874122 CAGTGCCATGATCAGGGCCAGGG - Intronic
1119210811 14:72830506-72830528 CAGTGCCTTGCTCAAGGTCAGGG - Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1121574352 14:94971179-94971201 CTCTGCCATCCTCAGGGTTTGGG + Intergenic
1121992387 14:98572202-98572224 CTCTGCCATGTTCAGCATGATGG + Intergenic
1122695096 14:103548583-103548605 CTGTGCCAGGCTCCAGGTAAAGG + Intergenic
1122883699 14:104701217-104701239 ACGTGCCATGCTGAGGGTTAGGG - Intronic
1123054345 14:105562078-105562100 CCGTGCCCTGCACAGGGGGACGG - Intergenic
1123078929 14:105682497-105682519 CCGTGCCCTGCACAGGGGGACGG - Intergenic
1127539639 15:59924225-59924247 CTGTGCCAAGCCCCGGGTTAAGG + Intergenic
1132061328 15:98694521-98694543 CTGGGCCAGACTCAGGGTGGGGG + Intronic
1133135729 16:3710202-3710224 ATGAGCAAAGCTCAGGGTGAGGG - Intronic
1133517577 16:6524690-6524712 CTGGGCCATGCTCCCTGTGAGGG + Intronic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1135625339 16:23990044-23990066 CTCTGCCATGCTCAGGATGTCGG - Intronic
1137441567 16:48502949-48502971 CTGTGCTATGCTGAGGCTGGTGG - Intergenic
1138403155 16:56765603-56765625 CTGTGCCCTGTTCTGGTTGAGGG + Intronic
1139090835 16:63645005-63645027 TTGTACCATGCTCAGAGTGCTGG + Intergenic
1139282310 16:65781223-65781245 GTGTGCTGTGCTCAGGGTGAGGG - Intergenic
1140040476 16:71404152-71404174 TTGAGACATGCTCTGGGTGAGGG - Intergenic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1141539771 16:84710835-84710857 CTGAGCCAGGCTCAGGTTGCAGG + Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143855069 17:9842428-9842450 CTGTGGCATGCTCAGGGGAACGG + Intronic
1144169743 17:12648324-12648346 CTGTCTCACCCTCAGGGTGAAGG + Intergenic
1144328739 17:14206072-14206094 TTGTGCCAGGCTCTGGGGGATGG + Intronic
1144584208 17:16478075-16478097 CTGGGCCATGCTCTGAGGGAGGG - Intronic
1146434179 17:32828032-32828054 CTCTCCCATGCTCAGGGTTTTGG - Intronic
1147176211 17:38657750-38657772 CAGAGCCAGGCTCAGAGTGAGGG + Intergenic
1147304867 17:39556332-39556354 CAGTGGCATTCTCAGGGTCAGGG - Intronic
1147387583 17:40091203-40091225 CTGTGGCAGGCTGAGGGTCAGGG - Intronic
1148233745 17:45953461-45953483 CTGTCCCAGGATCAGGGTGGAGG + Intronic
1148588810 17:48800123-48800145 CTGTGCCATGGTCACCTTGATGG - Intronic
1149561202 17:57609116-57609138 CTGAGCCCTGCCCAGGGAGATGG - Intronic
1151586512 17:75012181-75012203 ATGTGCCATGTTCTGGGTGCTGG + Intergenic
1151769595 17:76151359-76151381 CTGTGTCTTGCACAGGCTGATGG + Intronic
1152188055 17:78870859-78870881 CTGTGCCAGCCTCCGGCTGATGG + Intronic
1152364134 17:79845181-79845203 CTGTTCCGTGCTCAGGGCGCAGG - Intergenic
1154331253 18:13430580-13430602 CTGTGTCTTGATCAGGGTGCTGG + Intronic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1156736928 18:40271330-40271352 CTGGACCATGTTCAGTGTGAGGG + Intergenic
1156828945 18:41467405-41467427 TTGTGCCATGCTCTGGGAAAGGG - Intergenic
1157946273 18:51984263-51984285 AGTTGCCATGCCCAGGGTGATGG + Intergenic
1158294489 18:55979818-55979840 CTGTGCCATACTCAGGGGCATGG + Intergenic
1158499122 18:57984089-57984111 CTGTGACATGGTCATGGTAAGGG - Intergenic
1159613126 18:70548248-70548270 ATGTGCCATGGGCAGGGAGAAGG + Intergenic
1159954829 18:74511904-74511926 CAGTACCTTGCTCAGAGTGAGGG - Intronic
1161135860 19:2619477-2619499 CTGAGCCCTAATCAGGGTGAAGG + Intronic
1161309740 19:3586956-3586978 CTGCACCAGGCGCAGGGTGAAGG - Exonic
1161546037 19:4880670-4880692 CAGTGTCATGCTCAAAGTGAGGG + Intergenic
1162279309 19:9682409-9682431 CTTTGGGAGGCTCAGGGTGAGGG - Intergenic
1162797255 19:13093437-13093459 CTGTGCCCTGCCTAGGGTCAGGG - Intronic
1163018295 19:14470059-14470081 CTGTCCCAGGGTCAGGGTGGGGG - Intronic
1163250538 19:16124120-16124142 CTGTGACATGGTCAGGGACAGGG - Intronic
1164487367 19:28670295-28670317 CTATGCCATGATCTGGGTGGTGG + Intergenic
1164819281 19:31232636-31232658 CTATGTCTTGCTCAGGGTGGTGG - Intergenic
1165745476 19:38227994-38228016 CTGGGCCAGGGTCAGGGTGAGGG + Intronic
1166769416 19:45271882-45271904 CTGTGCCATGCTGGGGTTAAGGG + Intronic
1166886614 19:45965132-45965154 CTGTGACAAGTTTAGGGTGAGGG - Intronic
1167170407 19:47827338-47827360 CCCTGTCTTGCTCAGGGTGACGG + Intronic
1168682524 19:58326583-58326605 CTGTGTGAGGCTGAGGGTGAGGG - Intergenic
1168682538 19:58326651-58326673 CTGTGTGAGGCTGAGGGTGAGGG - Intergenic
925085602 2:1105264-1105286 CTGTGCCATGCAGAGGGTCTTGG + Intronic
925425578 2:3746684-3746706 CTGTGCAATCCTCAGTGTCAAGG - Intronic
925787397 2:7446285-7446307 GAGTACCATGCTCAGGGTCATGG + Intergenic
925906876 2:8544981-8545003 CTGTGCCCTGCTCCCTGTGAGGG - Intergenic
926154634 2:10446802-10446824 CTATGACAGGCCCAGGGTGACGG + Intronic
927273235 2:21237340-21237362 CTGTGCCATCCCCAGAATGAAGG + Intergenic
929456984 2:42073012-42073034 CTGTGCTATCCCCAGGATGAGGG + Intergenic
929559683 2:42948266-42948288 ATGTGCCCAGCTCTGGGTGATGG - Intergenic
929670532 2:43873716-43873738 CTGTGACATTCCCAGGGTCACGG + Intronic
931923069 2:67041781-67041803 CTTTGCCATGTTCAGGGTATTGG - Intergenic
933761997 2:85678913-85678935 CTGTTCCAGGCACAGGGTGGGGG + Intergenic
934238767 2:90251051-90251073 CTGTGCTAGGGTCAGTGTGAGGG - Intergenic
934274429 2:91565659-91565681 CTGTGCTAGGGTCAGTGTGAGGG + Intergenic
935716409 2:105943053-105943075 GGATCCCATGCTCAGGGTGAAGG + Intergenic
936034251 2:109098020-109098042 CTGTGGCAGGAACAGGGTGAGGG + Intergenic
938110752 2:128563315-128563337 CTGTTCCCTGCACAGGGTGATGG + Intergenic
938266689 2:129933179-129933201 CTGTGCAATGTGCAGGGTGGTGG + Intergenic
940049260 2:149444350-149444372 CTGTTGAATGATCAGGGTGATGG + Intronic
941509718 2:166390580-166390602 ATGTGCCAAGCTCAGTGTTAAGG - Intergenic
941545172 2:166841301-166841323 CTGTCCCCTGCTCAGGCTGCAGG - Intergenic
947972505 2:234336025-234336047 GTGTGCCAGGCACAGGGTGCGGG + Intergenic
948133012 2:235614667-235614689 GTGTGCCAGGCTCAGGGGCAGGG + Intronic
949045219 2:241869791-241869813 CTCGGCCATGGCCAGGGTGAAGG - Exonic
1171975807 20:31593943-31593965 CTGGGCCCTGCCCAGGGTGGAGG - Intergenic
1172598474 20:36167251-36167273 ATGTGACAGGCTCATGGTGATGG + Intronic
1172756490 20:37288954-37288976 CTGTGCTCTGCTCTGGGAGATGG + Intergenic
1174005191 20:47405040-47405062 CTCTGCCATCCTCAGTGTGTCGG + Intergenic
1174510277 20:51046075-51046097 CTGTTCCATGTTCAGGGTACAGG + Intergenic
1175072569 20:56346525-56346547 CTATGCCAGGCGCTGGGTGATGG - Intergenic
1176230084 20:64028114-64028136 CTGCGTCCAGCTCAGGGTGACGG + Intronic
1176239068 20:64067626-64067648 TTGTGCCATGCACAGCCTGAGGG - Intronic
1176673233 21:9753254-9753276 CTCTGCCTGGCTCAGGGTTAAGG - Intergenic
1178141215 21:29685963-29685985 CTGACCCATGCTCAGGAGGAAGG + Intronic
1180244145 21:46535047-46535069 CTGTGACATACTGAGGGTCAGGG + Intronic
1181345842 22:22220074-22220096 CTGCTCCATCCTCAAGGTGAAGG - Intergenic
1183062650 22:35345557-35345579 CTGTGCCAGGCTGTGGGTGATGG - Intronic
1183516667 22:38270834-38270856 CTGAGCCCTTCTCAGGGTGAGGG + Intronic
1184302445 22:43569612-43569634 CTGTGCCACGCTAAGGCAGAAGG - Intronic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184504361 22:44892002-44892024 CTGCTCCAGGCTCAGGGTCACGG + Intronic
1184850344 22:47116118-47116140 CTCAGCCAAGCCCAGGGTGAGGG - Intronic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
950874573 3:16259088-16259110 CTGTCCCATGATCATGTTGATGG - Exonic
950894647 3:16437781-16437803 CTGGGCCAGGATTAGGGTGAGGG - Intronic
951945548 3:28131851-28131873 CTATGCCATCTTCAGGGTGCTGG + Intergenic
953141981 3:40237564-40237586 CTGTGTCAGGCTCTGGGTGGTGG - Intronic
953344813 3:42166324-42166346 GAGTGCCAGGCTCATGGTGAGGG + Intronic
953658256 3:44871235-44871257 CTGTGCCATGCTATGGGCTAGGG + Intronic
955194877 3:56795921-56795943 CTGTGTCATGCCCAGTGTGGTGG - Intronic
956740522 3:72272165-72272187 CTGATGCATTCTCAGGGTGATGG + Intergenic
961209221 3:125112454-125112476 CTGTGAGGTGCTCAGGGTGCTGG - Intronic
962002752 3:131316432-131316454 CTGTGTCATGCCTAGGATGATGG - Intronic
962312895 3:134338453-134338475 CTGAGACAAGCTCAGGGAGAGGG - Intergenic
963230318 3:142903025-142903047 TTGTGCTTTGCTCAGGGTCAGGG - Intergenic
963467625 3:145702612-145702634 ATCTGCCATGGTCAGGGTCAGGG - Intergenic
963608588 3:147436825-147436847 CTGTGGACTGATCAGGGTGATGG + Intronic
965434230 3:168627521-168627543 TTGTGACATGCTCAGGGCTATGG - Intergenic
965639015 3:170813401-170813423 CTGTGCCATGGTCTGGTTGCAGG - Intronic
967142357 3:186571342-186571364 CAGTGCCAGGCTGAGGTTGAGGG + Intronic
967746406 3:193060665-193060687 CTGTGCCATGCTCAGCGTAGGGG - Intergenic
970367715 4:15377038-15377060 CTGTGCCAAGCACAGAGTGAGGG - Intronic
970496260 4:16628947-16628969 CTGAGCCAGGCACAGGGTGGGGG - Intronic
970628938 4:17920466-17920488 CTGCTGAATGCTCAGGGTGATGG + Intronic
971380834 4:26096098-26096120 CTGTGCCTTGTTCCGTGTGATGG + Intergenic
972565531 4:40265762-40265784 CTCTGCCATGGCGAGGGTGAAGG + Intergenic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
979473257 4:121125631-121125653 GTGGACCATGCCCAGGGTGAAGG + Intergenic
982506067 4:156219132-156219154 CTTTTCCAGGCTCAGGGTGTAGG - Intergenic
984326135 4:178253554-178253576 CTGTTCCCTGATCAGGGTGATGG + Intergenic
985401474 4:189598429-189598451 CTCTGCCTGGCTCAGGGTTAAGG + Intergenic
986257342 5:6111158-6111180 GTGTGCCAAGATCTGGGTGAAGG + Intergenic
987383799 5:17310534-17310556 CTGTCACATGATCAGGGTGGAGG - Intergenic
988012596 5:25509154-25509176 TTTTGCCATGCTTAGGGCGAAGG + Intergenic
991398068 5:66225325-66225347 CTGTGTCTGCCTCAGGGTGAGGG + Intergenic
992611482 5:78511887-78511909 CTGTGCCAAGCACTGGGTAAGGG + Intronic
998129720 5:139645566-139645588 CAATGCCCTGCTCAGGGTAAGGG + Intergenic
999014908 5:148092007-148092029 TTTTGCCATGCTCTGGGTGTGGG + Intronic
999363131 5:151003040-151003062 CAGTGCCATGCACAGAGTAAAGG - Intergenic
999614947 5:153413231-153413253 CTGTGCCTAGCACAGTGTGAAGG + Intergenic
1001574218 5:172751408-172751430 AGGTGCCCTGCCCAGGGTGAGGG + Intergenic
1004323967 6:14656751-14656773 CTGTGTCTTGTTCTGGGTGATGG - Intergenic
1006314340 6:33281106-33281128 CTGTGGAGTGTTCAGGGTGATGG - Intronic
1006602340 6:35234280-35234302 CTGTGGCATGCTGAGGATGGGGG + Intronic
1006836589 6:37002691-37002713 CTGTGCCATCTTCAGGGTTAGGG + Intergenic
1006877967 6:37315023-37315045 CTGTGCTAGGCTCCGGTTGAGGG - Intronic
1007989228 6:46237996-46238018 TTGGGCCAGGCTCAGGGGGAAGG - Intronic
1008318178 6:50072611-50072633 CTGTGCCTTGAACAGAGTGATGG - Intergenic
1010089963 6:71969056-71969078 CAATGCCATACTCACGGTGAAGG - Exonic
1011254020 6:85402863-85402885 CTGTGCAGTGGACAGGGTGATGG - Intergenic
1011500134 6:87979187-87979209 CTGTGACCTGCTCATGGTCAAGG - Intergenic
1014876090 6:126661934-126661956 CTTTCCCATCCTCAGAGTGATGG + Intergenic
1016041570 6:139437086-139437108 CTGGGCCATGCCCAGGCTGAAGG + Intergenic
1017722137 6:157251004-157251026 CTGTGGTAAGCTCAGGGAGATGG - Intergenic
1017770232 6:157638917-157638939 CTGGGCCTTGCTCAGGCTGTGGG - Intronic
1018102925 6:160457236-160457258 CTGTTCCATGCTGAAGGTGGAGG - Intergenic
1019340074 7:504714-504736 CTGTGCCATCCGGAGGGTCAGGG - Intronic
1019444525 7:1064491-1064513 CTGTGGGAAGCTCAGGGTCAGGG - Intronic
1019527682 7:1488013-1488035 GTGGGCCACGCTCAGGGTCAAGG + Intronic
1019542827 7:1559274-1559296 CTGTGCCAGGGCCAGGGTGTGGG - Intronic
1019803683 7:3106857-3106879 ATGTACCAGCCTCAGGGTGAGGG - Intergenic
1020363051 7:7350315-7350337 CTGTGCCATTCACAGAGAGATGG + Intergenic
1021569189 7:22047144-22047166 CTCTGCAAGGCACAGGGTGAGGG + Intergenic
1024765609 7:52654633-52654655 CTGTCCCAAACACAGGGTGACGG + Intergenic
1026546999 7:71331788-71331810 CCGTGACAAGCTCAGGGGGAAGG - Intronic
1026979047 7:74515987-74516009 CTGTGCCATGCTCAGGGTGATGG - Intronic
1031871497 7:127093024-127093046 CTGTGGCATGCTGAGGGTAGGGG - Intronic
1032478323 7:132227195-132227217 CTGTTCCTTGCCCAGGATGAGGG + Intronic
1035040338 7:155922186-155922208 CTGGGCCTTGCTCCTGGTGACGG + Intergenic
1035349771 7:158237887-158237909 CTGTGCTGAGCTCAGCGTGAGGG - Intronic
1035731017 8:1853633-1853655 CTGTGCCATCCTCAGGGCCCTGG - Intronic
1035928752 8:3758249-3758271 CTGTGCAAGGCTGAGTGTGATGG - Intronic
1036561260 8:9902198-9902220 CTCTGCCATGCTCGGGGGAAGGG + Intergenic
1036655730 8:10675978-10676000 TAGTGACATGTTCAGGGTGAGGG + Intronic
1037706314 8:21318007-21318029 CTTTGCCTTGCTCTGGGTGGTGG - Intergenic
1040085999 8:43342513-43342535 CTGTACCTTTCTCAGTGTGAAGG + Intergenic
1040417461 8:47207782-47207804 CTGAGCCAGGCTCAGGGAGAAGG - Intergenic
1040985875 8:53294016-53294038 GTGTGTCATGCTCATGGTGATGG + Intergenic
1041365168 8:57094728-57094750 CTGTGCCATGCTTACTGTGGTGG + Intergenic
1041770875 8:61471577-61471599 CTTGGCCATGCTCTGGGTGCAGG - Intronic
1042562164 8:70080545-70080567 CTGGGCCACACTCAGGGTTAGGG - Intergenic
1043348326 8:79326465-79326487 CTTTTCCATGCTCAGTGAGAAGG - Intergenic
1045648085 8:104318644-104318666 CTGTACCTTGCTCATGGTGGTGG - Intergenic
1046425248 8:114039197-114039219 CTGTCCAATGCTGAGAGTGATGG - Intergenic
1049404423 8:142445373-142445395 CTGTCCCATCCTCAGGGAGGGGG - Intergenic
1049633394 8:143672089-143672111 CTGTGCCTTGCGCAGGGCGGGGG + Intergenic
1049708518 8:144053534-144053556 CTGAGCCAGGCTCAAGGAGAGGG - Intronic
1051661543 9:19431593-19431615 CTGCTCCAGCCTCAGGGTGAGGG - Intronic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1055286076 9:74729425-74729447 ATGTGCCAAGCTCAGAATGAGGG + Intronic
1055297694 9:74851335-74851357 CTGTGAAATGCTCTGAGTGATGG - Intronic
1057482505 9:95456407-95456429 GTGTGCCCTGCTCCAGGTGATGG - Exonic
1059461071 9:114430532-114430554 AGGTGCCAGGCTCAGGGTGAGGG - Intronic
1060235016 9:121856755-121856777 GGGTGCCATGCTGAGGGAGACGG - Intronic
1060548328 9:124473652-124473674 CTGTGACATTCTCAGCCTGAGGG + Intronic
1060852626 9:126889996-126890018 CTGTGCCCTGATCAGGCTGGTGG + Intergenic
1061135139 9:128729453-128729475 CTGTGCCACCATCAGGGAGAAGG - Intergenic
1061515198 9:131085714-131085736 CAGTGCCAAGGTCAGGGTGGTGG + Exonic
1062287541 9:135779720-135779742 CTGGTCCCTGCTCAGGGAGATGG - Intronic
1187359233 X:18609482-18609504 CTGTGCCATCATCAGAGTGTGGG - Exonic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189334876 X:40165016-40165038 AAGTGCCAAGCTCAGGGAGATGG + Intronic
1190544242 X:51508514-51508536 CGGTGTCATTCTCAGTGTGAAGG - Intergenic
1192219863 X:69190386-69190408 CTGTACCAAGCACAGAGTGATGG - Intergenic
1192551936 X:72061507-72061529 ATGGGCCAGGATCAGGGTGACGG - Intergenic
1194741085 X:97575227-97575249 CTGTGCCACGCTCCCTGTGAAGG + Intronic
1195614042 X:106898824-106898846 CTGTCTCATGCTGAGGGAGAAGG + Intronic
1197593678 X:128441183-128441205 CTATGCCATGCCTAGGGCGATGG - Intergenic
1198366950 X:135950717-135950739 CAGTGGCATGCTCATGGTCATGG + Intergenic
1198685285 X:139222416-139222438 CTGTGCCTTGATCAGTGTGTTGG + Intronic
1200117835 X:153776939-153776961 CTGGGCCAGGCTCTGGGAGATGG - Exonic
1200708793 Y:6465534-6465556 CTCTGCAAGGCTCAGGATGAAGG - Intergenic
1201025319 Y:9699175-9699197 CTCTGCAAGGCTCAGGATGAAGG + Intergenic