ID: 1026979409

View in Genome Browser
Species Human (GRCh38)
Location 7:74517853-74517875
Sequence CCAGGTGCCCAGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 484}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026979397_1026979409 3 Left 1026979397 7:74517827-74517849 CCTTGAGTCCCCGATTTCCCCTC 0: 1
1: 0
2: 6
3: 72
4: 353
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979394_1026979409 24 Left 1026979394 7:74517806-74517828 CCTCTGCTCTGTCCTCTGGGCCC 0: 1
1: 0
2: 8
3: 90
4: 705
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979400_1026979409 -6 Left 1026979400 7:74517836-74517858 CCCGATTTCCCCTCCAGCCAGGT 0: 1
1: 0
2: 1
3: 31
4: 235
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979401_1026979409 -7 Left 1026979401 7:74517837-74517859 CCGATTTCCCCTCCAGCCAGGTG 0: 1
1: 0
2: 3
3: 30
4: 292
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979396_1026979409 4 Left 1026979396 7:74517826-74517848 CCCTTGAGTCCCCGATTTCCCCT 0: 1
1: 0
2: 4
3: 66
4: 319
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979398_1026979409 -5 Left 1026979398 7:74517835-74517857 CCCCGATTTCCCCTCCAGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484
1026979395_1026979409 12 Left 1026979395 7:74517818-74517840 CCTCTGGGCCCTTGAGTCCCCGA 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG 0: 1
1: 0
2: 1
3: 45
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026979409 Original CRISPR CCAGGTGCCCAGAGTGGAGA GGG Intronic
900308008 1:2020208-2020230 TCAGATCCCCAGAGAGGAGATGG - Intronic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
901229958 1:7636172-7636194 GCAGGTGCCCTGAGTTGAAAGGG + Intronic
902070088 1:13727078-13727100 CCATGTGTCCAGAGCAGAGAAGG - Intronic
902174245 1:14637454-14637476 CCAAGGGCACACAGTGGAGAAGG + Intronic
902196811 1:14804155-14804177 CCAGGAGCCAAGTGTGGAGGGGG - Intronic
902383665 1:16064505-16064527 CAAAGTGGACAGAGTGGAGAGGG - Intronic
902404029 1:16173479-16173501 CCAGGGGTCCAGAGAGGGGAAGG - Intergenic
902653368 1:17851512-17851534 CCAGGGGCCCAGAGATGAGAAGG + Intergenic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
903040000 1:20522516-20522538 CCAGGAGCACAGAATGGAGAAGG + Intergenic
903147036 1:21380869-21380891 CCAGGAGCCCTGTGTTGAGAAGG - Intergenic
903929894 1:26856110-26856132 CCTGGTGCCCAGGTTGGAGGTGG - Exonic
904008088 1:27374221-27374243 CCGGGTGCCCAGCCTGGAGCTGG + Intronic
904377838 1:30092966-30092988 GCAGGGGCCCAGTGAGGAGATGG - Intergenic
904394264 1:30207737-30207759 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
904772934 1:32890960-32890982 CCAGGTGGCCAGAATGGTGGAGG + Intronic
904879768 1:33686737-33686759 CCAGGGGCACAGACAGGAGAAGG - Intronic
906055455 1:42912615-42912637 CCAGGTGCCCAGCTTGGGGGTGG + Intergenic
906255335 1:44344870-44344892 CCAGGTCCCCAGTGGGGACAGGG + Intronic
907242212 1:53087094-53087116 ACAGGCGGCCAGAGTGCAGACGG - Intergenic
907285400 1:53376549-53376571 CGTGGAGCCCAGAATGGAGAGGG + Intergenic
908045532 1:60163911-60163933 CCAGCTCCCCAGAGTAGACAGGG + Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909599011 1:77441782-77441804 GCAGGTGCCCAGAGTGGCTGTGG + Intronic
909975564 1:82042583-82042605 CCAGGTGCTCAGACTGCAAATGG - Intergenic
910310902 1:85823561-85823583 CCAGGTGACCAGGGTGAACAAGG - Exonic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
912961697 1:114201709-114201731 CCCGGTGTCCAGAGTGGGCAGGG - Intergenic
912975726 1:114328636-114328658 CTAGGCGCCCAGGGTGCAGATGG + Intergenic
913433980 1:118827666-118827688 CCAGGTCTCCAGGGTGGAGGAGG - Intergenic
914893955 1:151651936-151651958 CCAGGTGCCGGGATTGCAGACGG - Intronic
915145597 1:153794322-153794344 GGAGGTGGCCGGAGTGGAGATGG + Intergenic
915702255 1:157807104-157807126 GCAGGTTCACAGAGTGGAGCTGG + Exonic
916108641 1:161447903-161447925 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916110229 1:161455284-161455306 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916111814 1:161462694-161462716 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916113401 1:161470075-161470097 CCAGGTGCCCGGCGGGGACACGG + Intergenic
917220473 1:172723206-172723228 CCAGGTGTCAAGAGTAGGGAAGG + Intergenic
918114007 1:181482117-181482139 CCAGGTGCTAAGTGGGGAGATGG + Intronic
918147979 1:181774628-181774650 CCTGCTGCCTAGAGTAGAGATGG - Intronic
918255467 1:182742473-182742495 CGAGGTGCCGAGATTGCAGACGG - Intergenic
919587366 1:199455390-199455412 CCAAGTGCTCAAACTGGAGAAGG + Intergenic
919640349 1:200039713-200039735 CATGCTGCCCAAAGTGGAGACGG + Exonic
920097608 1:203496751-203496773 ACTGGGGCCCAGAGAGGAGAGGG - Intronic
920200299 1:204256137-204256159 CCAGGAGGCCAGAGTGGAGGAGG - Intronic
920269495 1:204752377-204752399 GCAGGTGCCGGGAGTGGAGAGGG - Intergenic
921003520 1:211068973-211068995 CCAGGTTCTCACAGTGAAGACGG + Intronic
922749501 1:228063949-228063971 GCTGGGGCCCAGAGAGGAGATGG + Intergenic
922754254 1:228086038-228086060 CAATTTTCCCAGAGTGGAGAGGG + Intronic
924202147 1:241671723-241671745 CAAGGTGTTAAGAGTGGAGAGGG - Intronic
1063378994 10:5572531-5572553 CCAGCTGCCCTGAGTGGTGCTGG - Intergenic
1063453010 10:6163906-6163928 CCAGGTCCCCAGAGCGTAGGGGG - Intronic
1064032360 10:11890976-11890998 TCAGGTACCCTGAGGGGAGAGGG + Intergenic
1065737946 10:28771429-28771451 CGAGGTGCCGGGAGTGCAGACGG + Intergenic
1069566275 10:69465376-69465398 CCAGAAGACCACAGTGGAGAAGG - Intronic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1073011769 10:100365634-100365656 ACAGGTGCACAAAGTGGAAACGG + Intergenic
1073488319 10:103835873-103835895 GCAAGTGCCCCAAGTGGAGAGGG + Intronic
1073544017 10:104334132-104334154 CCAGGTGCCCAGAGCCAAGGCGG - Intronic
1074047164 10:109849739-109849761 CCAGGTGCCCAGGATGGTAATGG + Intergenic
1074191252 10:111139560-111139582 CCAGGTCACCAGCGTGGAGCCGG + Intergenic
1074197635 10:111203281-111203303 GCAGGTGTTCAGAGTGGGGAGGG + Intergenic
1074386119 10:113018017-113018039 CTGGGTCCCCACAGTGGAGATGG + Intronic
1074862824 10:117525171-117525193 CCAGAGGCAGAGAGTGGAGAGGG + Intergenic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1075962869 10:126584502-126584524 CCCAGTCCCCAGAGTGCAGATGG - Intronic
1075979577 10:126724914-126724936 CCAGCTGCTCAGGGTGGGGAGGG + Intergenic
1076996229 11:298777-298799 CCAGGTGCCCAGGGTGTGGGTGG - Intronic
1077181573 11:1219419-1219441 CCAGGTGTCCAGCGTGGAGCTGG + Intergenic
1077411871 11:2407472-2407494 CCAGGAGAGCAGAGTGGACAGGG - Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1078253478 11:9637711-9637733 CCAGCTGCTCAGGGTGGAGTAGG - Intergenic
1078266584 11:9759513-9759535 CCAGGAGGCAGGAGTGGAGAGGG + Intergenic
1078668006 11:13341942-13341964 CCTGGTCCCCAGAGTGGAAGTGG + Intronic
1078856038 11:15206991-15207013 CCAGGTACTCTGAGTGGTGAAGG + Intronic
1078872788 11:15364484-15364506 CCATGTGTCCAGAGTGTAAATGG - Intergenic
1079006818 11:16797330-16797352 CTAGGTGCCTCGAGAGGAGATGG - Intronic
1080914219 11:36638896-36638918 CCAGGTGGAAAGATTGGAGATGG + Intronic
1081613109 11:44575268-44575290 ACAGGCTCCCAGAGAGGAGAGGG - Intronic
1081772985 11:45661224-45661246 CCAAGGGCCCCGGGTGGAGAAGG + Intronic
1081871281 11:46383656-46383678 CTAAGTGCCCAAAGTGGGGAGGG + Exonic
1083269238 11:61562966-61562988 CCAGCTGCCCAGAGGGGAACGGG + Intronic
1083376878 11:62230823-62230845 GCAGGAGGCCAGAGTAGAGAAGG - Intergenic
1083553163 11:63606209-63606231 CCAGGTGCCTAGATTGGTGCCGG - Intronic
1083607637 11:63988273-63988295 CCAGCTGCCTGCAGTGGAGATGG + Intronic
1084010608 11:66346471-66346493 CCAGGTGCTCATAAGGGAGAGGG - Exonic
1084191262 11:67500040-67500062 CCAGGAGCCCAGCCTGGGGAGGG + Intronic
1084387428 11:68852868-68852890 TCAGGTGCCAGGAGAGGAGACGG + Intergenic
1084599019 11:70133875-70133897 CCAGCTGCCCAGGCTGGAGCAGG - Intronic
1084691628 11:70730601-70730623 CCAGGTGCCCAGGGTAGGAATGG - Intronic
1084719441 11:70894822-70894844 CCAGGGGCACACAGTGAAGAAGG - Intronic
1085020751 11:73205333-73205355 CCAGGTGCCCAGAATACAGCAGG - Intergenic
1085395023 11:76202790-76202812 CCAGGACTCCAGAGTGAAGAGGG + Intronic
1085465239 11:76719263-76719285 CCATGTGCCCATGGTGGAGATGG + Intergenic
1085699122 11:78730505-78730527 CCAGATGGACAGAGTGGGGAAGG + Intronic
1088318878 11:108534513-108534535 CAAGGTGCAGAGAGTGGAGAAGG - Intronic
1089257133 11:117199953-117199975 TCAGGGGCAAAGAGTGGAGACGG + Intronic
1089291745 11:117441532-117441554 ACAGGTGCCCAGAGTGTGGTGGG + Intronic
1089366226 11:117922715-117922737 GCAGGTGCACAGGGTGGAGCAGG + Intronic
1089541716 11:119193266-119193288 CCAGGGACCCAGGTTGGAGATGG + Intronic
1090022115 11:123137456-123137478 ACAGGGTCCCAGAGGGGAGATGG + Intronic
1090245255 11:125211673-125211695 CCAGCTGCCCAGGGTGGAGCCGG + Intronic
1090394092 11:126407648-126407670 GAAGGTGCCCAGACTGGAGTCGG - Intronic
1091795528 12:3295574-3295596 CCTGCTGCCCAGGGTGGAGATGG - Intergenic
1092105519 12:5919326-5919348 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105534 12:5919416-5919438 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105541 12:5919461-5919483 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105548 12:5919506-5919528 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092105555 12:5919551-5919573 CAAGGTGCCCAAAGCAGAGAGGG + Intronic
1092743658 12:11653507-11653529 CAAGGAGCCCAGAGTCCAGAAGG - Intronic
1093255131 12:16857393-16857415 CCAGGTGGGCAGAGTGGCTAAGG - Intergenic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1096561372 12:52438136-52438158 CCAGGGGCCGAGTGTGGAGAAGG + Intergenic
1096561380 12:52438178-52438200 CCAGGGGCCGAGTGTGGAGAAGG + Intergenic
1096561388 12:52438220-52438242 CCAGGGGCCGAGTGTGGAGAAGG + Intergenic
1096561396 12:52438262-52438284 CCAGGGGCCGAGTGTGGAGAAGG + Intergenic
1096601094 12:52730155-52730177 CCAGGTGGCCAAAGTGGACCTGG - Intergenic
1096812611 12:54181275-54181297 CAAGGTATCCAGAATGGAGAGGG + Exonic
1098239585 12:68453228-68453250 CCATGTGCCAGGAGTGGAGAGGG + Intergenic
1098595686 12:72271949-72271971 TAAAGTGCCCAGGGTGGAGAAGG + Intronic
1101528240 12:105551084-105551106 CCAGGTGGCCAGAGCAGAGGAGG - Intergenic
1101945031 12:109130140-109130162 CATGGTGCTCTGAGTGGAGATGG + Intronic
1102167021 12:110814845-110814867 CCAGGTGCCCAGAAAGTGGAAGG - Intergenic
1102191909 12:110995071-110995093 CCAGGAGCTCAGGGTGGAGGAGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102525960 12:113512551-113512573 CCAGGTGGCCGCAGTGGAGGAGG - Intergenic
1102811428 12:115827525-115827547 CCAGGTGCCAAGTGTGGCTAAGG - Intergenic
1102967517 12:117139724-117139746 CCAGGTGTCCTGTGTGGAAAAGG + Intergenic
1103641581 12:122356899-122356921 CGAGGTGCCGAGATTGCAGACGG + Intronic
1103669863 12:122604717-122604739 CCTGGTGCCTAAAATGGAGAAGG + Intronic
1104035012 12:125092033-125092055 CCAGCTGCCCAGAGTGGCCCAGG + Intronic
1104310322 12:127648997-127649019 CCTGGTGCCTGGAGGGGAGAGGG - Intergenic
1105889033 13:24668911-24668933 ACAGGTGCCCAGACCCGAGATGG + Intergenic
1105962671 13:25356186-25356208 CCTGGAGCCCAGAGTGGGGCAGG + Intergenic
1106291465 13:28366885-28366907 CCAGGAGCCCACAGTGGAGTGGG - Intronic
1108348037 13:49565276-49565298 CGAGGTGCCGAGATTGCAGACGG + Intronic
1109144414 13:58759904-58759926 CTAGGTGGTCAGTGTGGAGAAGG - Intergenic
1111706912 13:91761705-91761727 GCAGCTGCCCAGAGAGGACACGG - Intronic
1112250503 13:97774733-97774755 CGAGGTGCTCAGATTGCAGACGG + Intergenic
1112456301 13:99566678-99566700 GCAGGTGCTGTGAGTGGAGATGG - Intergenic
1112463749 13:99625216-99625238 CCAGGTTCCCAGAAGGGACAGGG - Intronic
1112470746 13:99686353-99686375 CCAGATGCTCAGAGGGGAGGTGG - Intronic
1113574848 13:111388112-111388134 GCAGGTGCCCAGAGCAGAGGTGG - Intergenic
1114247756 14:20930501-20930523 CCAGGTGGCTGGACTGGAGAAGG - Intergenic
1116930881 14:50689199-50689221 CCAGCTGCCAAGGGTGGAGGAGG + Intergenic
1117344319 14:54817891-54817913 TCAGGAGCCCAGAGCAGAGAAGG + Intergenic
1118974137 14:70663036-70663058 TCAGGTGACCAGAGTGGAGGCGG - Intronic
1119740723 14:77012256-77012278 CCCGGTGTCCAGAGGGGAGCTGG + Intergenic
1119877250 14:78071354-78071376 TCAGCTGCCCACAGTGGAGGTGG + Intergenic
1121228694 14:92340666-92340688 CCAGATGCCCAGAGGTGAAAAGG - Intronic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1121613677 14:95298468-95298490 CCAGCACCCCAAAGTGGAGAGGG + Intronic
1121705357 14:95989222-95989244 CCAGGACCCCACAGTTGAGAAGG - Intergenic
1122327817 14:100893003-100893025 GCAGATGCCCAGAGTGGGGTTGG + Intergenic
1122424817 14:101599702-101599724 ACAGATGCCCACAGTGGGGATGG + Intergenic
1123154437 14:106210798-106210820 CCAGGTGCCCAGGGAGGTTAAGG - Intergenic
1123211123 14:106761865-106761887 CCAGATTCACAGAGTGGAAAAGG - Intergenic
1126207326 15:46060192-46060214 CCAGGTGCCAAGGCTGGAGGAGG + Intergenic
1127533607 15:59869007-59869029 CCAGGGTCCCATAGGGGAGATGG - Intergenic
1128129244 15:65214793-65214815 CCAGGACCCCAGAATAGAGAGGG + Intergenic
1128246255 15:66134698-66134720 ACAGGGGCCCAGCGGGGAGAAGG + Intronic
1128318779 15:66678292-66678314 CCAGCTGCCCAAAGAGGAGGAGG + Intronic
1128878753 15:71224011-71224033 TCAAGTGCCCAGGGAGGAGAGGG + Intronic
1128880308 15:71236408-71236430 ACAGGTCCTCAGAATGGAGAGGG - Intronic
1129270365 15:74416231-74416253 CCAGGTCCCCACAGAGCAGACGG + Intronic
1129462133 15:75704769-75704791 CTAGCAGCCCAGAGCGGAGAGGG + Intronic
1129691775 15:77717871-77717893 CAAGGGGGCCCGAGTGGAGAAGG + Intronic
1129722725 15:77887077-77887099 CTAGCAGCCCAGAGCGGAGAGGG - Intergenic
1130907268 15:88249527-88249549 CCAAGGGCCCAGAGTGGGCAGGG - Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1132310502 15:100854138-100854160 CCCCGGGCCCACAGTGGAGAGGG + Intergenic
1132708713 16:1257212-1257234 GCAGGTGCCCTGAGCAGAGACGG + Intronic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1132806852 16:1778905-1778927 CCACCTGCCCAGAGCTGAGATGG + Intronic
1132859358 16:2062427-2062449 CCAGCAGCCCAGTGTGGAGAAGG + Intronic
1135563891 16:23497134-23497156 CCAGATGGCCAGAGGGGAGTTGG - Intronic
1135646874 16:24170807-24170829 GCAGGTGCCCAGAGAGGGAAAGG - Intronic
1135663535 16:24316716-24316738 CCAGGAGCCAAGGGTGGGGAAGG - Intronic
1136027201 16:27476351-27476373 CCAAGAGCCCACAGCGGAGAAGG + Intronic
1136289325 16:29262023-29262045 CCAGGTGCCTAGACTTGGGAAGG + Intergenic
1136714727 16:32269262-32269284 CCAGGTTCCAAGTGTGGTGAGGG - Intergenic
1136753182 16:32660485-32660507 CCAGGTTCCAAGTGTGGTGAGGG + Intergenic
1136814931 16:33209880-33209902 CCAGGTTCCAAGTGTGGTGAGGG - Intronic
1136821407 16:33319960-33319982 CCAGGTTCCAAGTGTGGTGAGGG - Intergenic
1136827970 16:33376499-33376521 CCAGGTTCCAAGTGTGGTGAGGG - Intergenic
1136833036 16:33475270-33475292 CCAGGTTCCAAGTGTGGTGAGGG - Intergenic
1137463064 16:48683303-48683325 CCAGATGCAAGGAGTGGAGAAGG + Intergenic
1138037645 16:53625025-53625047 CCAGGTGCCGGGATTGCAGACGG + Intronic
1138131280 16:54482145-54482167 CCAGGGGCCCAGATTGGAGGTGG + Intergenic
1138137438 16:54535671-54535693 GTAGGTGCCCAGAGGGGTGAGGG + Intergenic
1139547937 16:67658394-67658416 TCAGCTGCCCTGAGCGGAGAGGG - Intronic
1139557805 16:67723774-67723796 CCAGGAGCCTAGAGTGGGAAAGG - Exonic
1141423881 16:83933347-83933369 GCAGGTGCCCAGCTTGGGGAGGG + Intronic
1141643796 16:85356826-85356848 CCAGTTGCTCAGAGAGGTGAGGG + Intergenic
1141815830 16:86408701-86408723 CCAGGTATCCAGAGCAGAGAGGG - Intergenic
1142095070 16:88235003-88235025 CCAGGTGCCTAGACTTGGGAAGG + Intergenic
1142250413 16:88989369-88989391 CCCGGTGCCCAGATTAGGGAAGG - Intergenic
1202993508 16_KI270728v1_random:32854-32876 CCAGGTTCCAAGTGTGGTGAGGG - Intergenic
1203055324 16_KI270728v1_random:920507-920529 CCAGGTTCCAAGTGTGGTGAGGG + Intergenic
1143181519 17:4987042-4987064 CCAGGTGTCCAGGATGGAGATGG + Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144829964 17:18125848-18125870 CCTGGACCCCAGAGTGGGGATGG + Intronic
1144955090 17:19015127-19015149 CCAGATGTCCATAGTGAAGAGGG - Exonic
1145868385 17:28255264-28255286 CCAGGTTCCCAGAGAGCAGCAGG + Intergenic
1145930375 17:28681061-28681083 TCTGTTGCCCAGACTGGAGATGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146619592 17:34387147-34387169 CCAGGTGGTCAGAGTGGAACAGG + Intergenic
1147134569 17:38427771-38427793 CCAGGATCCCAGAGAGGAGGGGG - Intergenic
1147326447 17:39672029-39672051 CTAGGTGCGCAGTGTGGAGACGG - Exonic
1147886441 17:43687622-43687644 GCAGGCCCCCAGAGCGGAGATGG + Intergenic
1147994034 17:44351636-44351658 CCAGGTGCCCTGGATGGAGAAGG + Exonic
1150136212 17:62696746-62696768 CCAGGTGGCCAGAGCGGGGCGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151503095 17:74505057-74505079 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1151597850 17:75088744-75088766 CCTGGTGTCCAGAGTCGAGGGGG - Intronic
1151668482 17:75558769-75558791 TCAGGTGCTCCGAGTGGAGTGGG + Intronic
1152186681 17:78861211-78861233 GCAGGTGCCCAGGCTGGACAGGG - Intronic
1152196919 17:78923875-78923897 TCACCTGCCCAGAGTGGAGGTGG - Intronic
1152233685 17:79127381-79127403 GCAGGTGTCCAGAGCGGTGAGGG + Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1154020840 18:10662901-10662923 TCAGTTTCCCAGAGTGGAGGAGG - Intergenic
1154089517 18:11344306-11344328 CGAGGTGCCGAGATTGCAGACGG + Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155927556 18:31673206-31673228 CAATCTGCCCTGAGTGGAGATGG + Intronic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157783863 18:50464712-50464734 CCAGCTGCACAGGGTGGGGAAGG + Intergenic
1158580458 18:58676461-58676483 ACATGTGACCAGAGTAGAGAGGG - Intronic
1158756520 18:60332059-60332081 TCAGCTGCACAGTGTGGAGAGGG - Intergenic
1158810829 18:61032124-61032146 CCAGGTGCCCAAGCAGGAGATGG + Intergenic
1159359304 18:67380867-67380889 GCAGGTGGTCATAGTGGAGAGGG + Intergenic
1160250331 18:77198015-77198037 CCAGGTGTGCAGAGAGGAAAGGG + Intergenic
1160733051 19:649819-649841 CCAGGGGCCCAGGCTGGGGATGG + Intronic
1160733089 19:649911-649933 CCAGGGGCCCAGGCTGGGGATGG + Intronic
1160733126 19:650003-650025 CCAGGGGCCCAGGCTGGGGATGG + Intronic
1160733146 19:650049-650071 CCAGGGGCCCAGGCTGGGGATGG + Intronic
1160733165 19:650095-650117 CCAGGGGCCCAGGCTGGGGATGG + Intronic
1160733222 19:650233-650255 CCAGGGGCCCAGGCTGGGGATGG + Exonic
1160963743 19:1736522-1736544 CCATGTGGACAGAGTCGAGAGGG + Intergenic
1161390282 19:4017049-4017071 CCAGGCCCCCAGTGTGCAGACGG - Intronic
1161522542 19:4732874-4732896 TCTGGGGCCCGGAGTGGAGATGG - Intergenic
1161650130 19:5479252-5479274 CAAGGCTCCCAGAGTTGAGATGG - Intergenic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162163760 19:8739039-8739061 CGAGGTGCCCGGATTGCAGACGG + Intergenic
1162199784 19:9011674-9011696 GCAGGTGCCCAGTGTGAAGGAGG + Intergenic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162802244 19:13118104-13118126 CCAGGGGCATAGAGAGGAGACGG + Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163746607 19:19052470-19052492 CCAGGGGCTGAGAGTGGGGAAGG + Intronic
1164858627 19:31544904-31544926 CTAAGTGGCCAGAGTGAAGAGGG - Intergenic
1165096461 19:33412422-33412444 CCTGGTGGCCAAAGGGGAGAGGG + Intronic
1165130679 19:33629910-33629932 CCAGGGGTCCACAGTGGTGAAGG - Intronic
1165356572 19:35308039-35308061 TGTGGGGCCCAGAGTGGAGAAGG + Intronic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1167334569 19:48876613-48876635 CCAGGTGCACAGAGTGGAACAGG + Intergenic
1167353506 19:48990280-48990302 CCAGGGCCCCAGGGTGAAGACGG - Intronic
1167369048 19:49070091-49070113 GGGGGTGCCCAGAGTGGAGGTGG + Exonic
1167729406 19:51242518-51242540 CCAGGTGCCGTGACTGCAGATGG - Intronic
1168306419 19:55438466-55438488 CCAGGTGCCCAGTATAGAGCAGG - Intronic
925003497 2:424691-424713 CAAGGAGGTCAGAGTGGAGAGGG + Intergenic
925189530 2:1871579-1871601 CCAGGTGGCTAGAGGGGTGAAGG + Intronic
925213732 2:2073909-2073931 CCAGGAGGCCAGAGTGCTGAGGG - Intronic
925254586 2:2472245-2472267 CCAGGTGCTGAGCCTGGAGAAGG - Intergenic
925407698 2:3616493-3616515 CGAGGTGCCCGGATTGCAGACGG - Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926333988 2:11849610-11849632 ACAGAAGCCCAGAGAGGAGAAGG - Intergenic
926412998 2:12624529-12624551 ACATGTGCCCAGAGTGGGTAGGG + Intergenic
927507364 2:23623192-23623214 CCAGGTCCCCAGGGTGGGGAAGG - Intronic
927879628 2:26681459-26681481 ACAGAGGCCCAGAGTGGGGAAGG - Intergenic
927945517 2:27132905-27132927 ACAGGTGCCCAGCCTGGAGAAGG - Exonic
928273580 2:29878867-29878889 CCAGGAATCCAGAGTTGAGAAGG + Intronic
929502854 2:42504971-42504993 CAAGGTCCACAGAGTGGTGATGG - Intronic
929791303 2:45024998-45025020 TCAGGTGCCCAGATTTGACATGG + Intergenic
930107102 2:47648929-47648951 TCAGGTGCCCAGATTGAAGCTGG - Intergenic
930730517 2:54723971-54723993 CCCTGAGCCCAGCGTGGAGAGGG - Intronic
931998287 2:67859880-67859902 CCTGGTGCTTAGAGTGGAGTAGG - Intergenic
932502990 2:72200778-72200800 TCAGGTGCCTAGAGAGGTGAAGG + Intronic
933502596 2:83134161-83134183 GGAGGTGCCAAGAGTGGAGTGGG - Intergenic
933950709 2:87326868-87326890 CCAGGCTCCCAGAGTGGGAAGGG + Intergenic
935742955 2:106167046-106167068 CCAGGTGCCTAGAGTATAGAAGG - Intronic
935946583 2:108292028-108292050 CTAGGTGCCCAGATTAGTGAGGG - Intronic
936186346 2:110306949-110306971 CCAGGTGCCGGGATTGCAGACGG + Intergenic
936272205 2:111057552-111057574 CCAGGGGCCAGGAGTAGAGAGGG + Intronic
937034174 2:118766840-118766862 CCAGGTGCACAGAGTTGGGTGGG + Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937250334 2:120519692-120519714 CCAGGGGCTCACAGTGGAGGGGG - Intergenic
937939153 2:127271719-127271741 CCAGGAGCCCAGAGATGAGAGGG + Intronic
938109104 2:128552403-128552425 GCAGATGCCCTGGGTGGAGATGG + Intergenic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938900929 2:135797999-135798021 CCTGGTGCCCGCAGTGGTGAGGG - Intronic
941361849 2:164561189-164561211 CCAGGTGTTCACAGTGGACAGGG + Intronic
941638941 2:167966983-167967005 CCAGGTGCACAGTCAGGAGATGG - Intronic
941663260 2:168216941-168216963 CCAGGAGCCCAGAGGGGCGCTGG + Intronic
942024569 2:171899500-171899522 CCAGGTGCCGGGATTGCAGACGG + Intronic
943950537 2:194128937-194128959 ACAGGTGCCCATAGTCCAGAGGG + Intergenic
943953442 2:194158393-194158415 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
946357756 2:219199193-219199215 CCAGCTGCCCAGGCTGGAGGAGG + Intronic
946758016 2:222965862-222965884 CCAGGTGCAGGGAGTGGAAATGG - Intergenic
947115115 2:226761540-226761562 ACAGTTGACCAGAGTGGAGAAGG - Intronic
947954738 2:234178900-234178922 CCTGGCGCCCAGAGTGCAGCAGG - Intergenic
948468033 2:238161484-238161506 CCAGGGTCCCAGAGTACAGAAGG + Intronic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1170494966 20:16915381-16915403 CTAGGTGCCCAAAGTCCAGAGGG - Intergenic
1170680084 20:18518615-18518637 CCATCTGCCTTGAGTGGAGAGGG + Intronic
1171265397 20:23767678-23767700 CCAGGAGCTCAGAGTATAGATGG + Intergenic
1171412962 20:24958818-24958840 GCAGGTGCCCACCGAGGAGAAGG - Intronic
1172126674 20:32628694-32628716 CCTGGTGGCCAGAGTGGAAGTGG + Intergenic
1173245629 20:41335621-41335643 CCAGGAGCCCATAGTGGGGTGGG - Intergenic
1173473113 20:43338764-43338786 CGAGGTGCCCAGATTGCAGACGG - Intergenic
1173497293 20:43528880-43528902 TTAGGGGCCCAGAGTGGAAAAGG + Intronic
1173657913 20:44713878-44713900 AGAGGTGGCCAGGGTGGAGATGG - Intergenic
1173698998 20:45049917-45049939 CCAGGTGAACAGTGTAGAGAGGG - Intronic
1173705578 20:45108066-45108088 ACAGAAGCCCAGAGTGCAGAAGG + Intergenic
1173914481 20:46696773-46696795 CTAGTTGCCCAGAGTGGAAATGG - Intergenic
1174287829 20:49484442-49484464 GCAGGTGGCCTGGGTGGAGAGGG - Intergenic
1174463667 20:50700697-50700719 CCTTGTGCCTAGAGTGGAGGGGG + Intergenic
1174864993 20:54127104-54127126 TCAGGTGGACAGAGAGGAGAGGG + Intergenic
1174916618 20:54660495-54660517 ACAGGTGCCCAGGGTGGTCAGGG - Intergenic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1175371506 20:58495921-58495943 ACAGGGGCCCAGCCTGGAGAGGG - Intronic
1175698988 20:61123753-61123775 CCATGGGCACAGTGTGGAGAAGG + Intergenic
1175989167 20:62779002-62779024 CCAGGATCCCAGGGTGGAAAAGG - Intergenic
1177160849 21:17546500-17546522 CCACGTGGCCAGAGCAGAGAAGG + Intronic
1177221725 21:18202443-18202465 GCATGTGCCAAGGGTGGAGAAGG - Intronic
1177599475 21:23291371-23291393 CCAGGTGTTCAGAGTGAGGAAGG + Intergenic
1178421011 21:32443142-32443164 CAAGGTGCTCAGAGCTGAGAGGG + Intronic
1178544373 21:33480414-33480436 CGAGCTGCCCAGAGTAGGGAAGG + Intergenic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
1179298083 21:40081218-40081240 CCAGCTAGCCAGGGTGGAGAAGG - Intronic
1180032571 21:45222366-45222388 GCAGGTGCGCAGTGTGGGGAGGG + Exonic
1180050888 21:45330573-45330595 CCAGGGCCTCAGAGTGGAGGGGG + Intergenic
1180140880 21:45892846-45892868 CCTGGCACCCACAGTGGAGACGG - Intronic
1180231181 21:46427632-46427654 CCGCGTGCCCCGATTGGAGAGGG + Exonic
1181446982 22:22984674-22984696 ATAGGTGCCCAGTGTGGACAAGG + Intergenic
1182281708 22:29221168-29221190 TCAGGCTCCCAGAGTGGAGCTGG + Intronic
1182548043 22:31086879-31086901 CCAGGTGGCAAGGGTGGGGATGG - Intronic
1183504395 22:38201349-38201371 CCAGGTGCCATGACTGGAGGTGG + Intronic
1184088799 22:42281863-42281885 GCAGGTGCCAGGAGTGCAGAGGG + Intronic
1184739796 22:46421229-46421251 CCAGGAGCCCAGAGAGGGGAGGG + Intronic
1184787776 22:46680167-46680189 CCAGGACACCAAAGTGGAGAGGG - Intergenic
949963919 3:9339073-9339095 CCAGAGGTCCAGTGTGGAGAAGG - Intronic
950195533 3:11006643-11006665 CCCCATGCCCACAGTGGAGAGGG + Intronic
950204817 3:11071300-11071322 ACAGGAGCCCACAGTGGGGAGGG + Intergenic
951226085 3:20122931-20122953 CCTGGTGGTCAGTGTGGAGAGGG + Intronic
952331259 3:32366375-32366397 CGAGGGGGCCAGAGAGGAGATGG - Intronic
952430556 3:33219056-33219078 CCAGGTGCCCAGCGCGAAGGCGG - Exonic
953535056 3:43770939-43770961 AGAGCTGCCCACAGTGGAGAGGG - Intergenic
953811240 3:46114656-46114678 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
954682179 3:52351684-52351706 CAAGGTGCCCAGTGTAGTGATGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
957620015 3:82584129-82584151 CCAGGTGCCCGGATTGCAGACGG + Intergenic
957880282 3:86203307-86203329 CAATGTGCCCATAGTGGAGGGGG + Intergenic
958600686 3:96293193-96293215 CAAGGTGCCCAGCGAGGAAATGG + Intergenic
961445652 3:126980107-126980129 TGAGGAGCCCAGAGTGGGGATGG + Intergenic
961474872 3:127140319-127140341 GCAGGTGCACAGAGTGGGGCTGG + Intergenic
962130096 3:132663284-132663306 CCAGTTACCCACAGTGGAGTAGG - Intronic
962583784 3:136820409-136820431 GCTGGTGGCCAGAGTGGAGCAGG + Intronic
963925347 3:150945023-150945045 CAAGGTGCCTAGGGTGGAAAAGG + Intronic
964533724 3:157696510-157696532 CAAGGTGACTAGAGTGGATATGG - Intergenic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968748695 4:2374917-2374939 CCAGGTGCCAACAGGGGACATGG - Intronic
969174841 4:5390587-5390609 CCAGGTACACACAGAGGAGAAGG - Intronic
969257584 4:6012945-6012967 GCAGGTGCCCAGCGTGGACTTGG - Intergenic
969292290 4:6247779-6247801 ACAGGTGCCCAGAGGGGGAAAGG + Intergenic
969315568 4:6379753-6379775 GGAGGAGCCCAGAGTGCAGAGGG - Intronic
971703695 4:30012768-30012790 TCAGGTGCCAAGAGTGGACTAGG + Intergenic
971905681 4:32722275-32722297 CTAGGTGCCCAGCTTGGGGAAGG + Intergenic
975647422 4:76558942-76558964 CCTGGGGCCCAGAGGGGAAAGGG - Intronic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
981157420 4:141455891-141455913 CCAGCTGCCCTGAGGGAAGAGGG + Intergenic
981748485 4:148072439-148072461 GCAGGTGCTCAGGGAGGAGAGGG - Exonic
981749598 4:148081379-148081401 CCAGCTGCCCAAGGTGGAGTCGG - Exonic
982294439 4:153812409-153812431 CCAGGAGCCCAGAGGTGAGTTGG - Intergenic
984943036 4:184950982-184951004 CCAGAGGGCCAGAGTGGTGACGG + Intergenic
985054694 4:186026110-186026132 TCAGGAGCACACAGTGGAGATGG - Intergenic
985764125 5:1768021-1768043 CCAGGGCCCCAGACTGGTGAAGG - Intergenic
985782433 5:1878256-1878278 CCAGGGCGCCAGAGTGGGGAAGG + Exonic
985952887 5:3236862-3236884 CCAGGATCCCAGAGTGGATGGGG + Intergenic
986092075 5:4519444-4519466 CCTGGAGCCCTGACTGGAGAGGG + Intergenic
986662668 5:10073358-10073380 CCAGGTCCCCGGCTTGGAGAAGG + Intergenic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987080819 5:14423807-14423829 CCAGATGTCCTGAGTGGGGAGGG - Intronic
988493201 5:31722402-31722424 TCAGCTGTACAGAGTGGAGAGGG - Intronic
991220561 5:64210888-64210910 CAAGGTGTCCAGTGAGGAGATGG + Intronic
996070183 5:119123038-119123060 CCAGGTGCCGGGACTGCAGATGG - Intronic
996738442 5:126777652-126777674 CAAGGTGCGCAGCCTGGAGACGG + Exonic
997235117 5:132268148-132268170 CCAGTGGCTCAGACTGGAGAAGG + Intronic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
998532072 5:142894611-142894633 TCAGGTGGACAGAGTGGAAATGG + Intronic
999060117 5:148624736-148624758 TCAGGGGCATAGAGTGGAGATGG + Intronic
999365898 5:151023201-151023223 CCACGTGCCCAGAGAAGGGAAGG + Intronic
999715841 5:154359281-154359303 CCAGCTGGTCTGAGTGGAGAGGG - Intronic
999809607 5:155115083-155115105 ACAGGAGCCCAGAGTGGAGGAGG - Intergenic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1001528276 5:172444669-172444691 CCATGTGCAGACAGTGGAGATGG - Intronic
1001779949 5:174359634-174359656 CCAGGTGCCCAGAGCAGAGTAGG - Intergenic
1001998626 5:176182289-176182311 CCCGGTCCTCAGATTGGAGATGG - Intergenic
1002540698 5:179904679-179904701 GTAGGTGCCCTGAGTGGTGAGGG - Intronic
1002601116 5:180354217-180354239 CGAGGGGCCCAGAGTGCAGGGGG - Intergenic
1003014792 6:2459884-2459906 CCTGGAGCCCAGAATTGAGAAGG + Intergenic
1003369883 6:5513831-5513853 CCAGGTTCCCAGGGTGGGGAAGG + Intronic
1006139955 6:31922384-31922406 CCAAGTGGCCAGACTGGATAAGG + Intronic
1006411774 6:33877978-33878000 CCAGGTACCCAGAATAAAGAAGG + Intergenic
1006418803 6:33920749-33920771 CCAGGTACCAAGAGAGGAGAGGG + Intergenic
1007091129 6:39185566-39185588 CTGGGAGCCCAGTGTGGAGAGGG - Intergenic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1007642795 6:43356082-43356104 ATGGGTGCCCAGAGTAGAGAGGG + Exonic
1013179797 6:107708183-107708205 TCAGCAGCCCAGAGTGCAGAAGG + Intronic
1013313084 6:108915766-108915788 CCAGCTGCCAAGAGTGGACTTGG + Intronic
1015070714 6:129089048-129089070 CGAGGTGCCGAGATTGCAGACGG - Intronic
1015712629 6:136158768-136158790 CCAGGTGTCCAGGGTGGACTGGG + Intronic
1016798438 6:148143168-148143190 ACAGGTGCCCGGAGTTGAAATGG - Intergenic
1017733555 6:157339657-157339679 TCAAATGCCCAGAGTGGAGGGGG + Intergenic
1017984862 6:159435141-159435163 CCAGGTGCTCACTGTGAAGATGG - Intergenic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1019302651 7:315774-315796 CCTGGTGCCCACACAGGAGAAGG - Intergenic
1019358570 7:593584-593606 CCAGGTGCGCCCAGAGGAGATGG + Intronic
1019389861 7:780001-780023 CCAGGTGACCAAGGTGGAGGCGG - Exonic
1019485761 7:1288551-1288573 TCCGGTGCCCAGAGAGGGGAGGG + Intergenic
1020476114 7:8597048-8597070 CCAGGTGGGCAAAGTGGGGATGG + Intronic
1020794547 7:12664157-12664179 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1020831595 7:13102215-13102237 CGAGGTGCCCGGATTGCAGACGG + Intergenic
1022514937 7:30969488-30969510 CCAACTGCCCAGGATGGAGAGGG + Intronic
1023354715 7:39355184-39355206 CCATGTGCCCAGATTGGGGAAGG + Intronic
1023818653 7:43968445-43968467 CCTGGTGCCCAGAAAGGATAAGG + Intergenic
1023887385 7:44368732-44368754 GCAGGTGCTCAGAGTGGCCATGG - Intergenic
1024014930 7:45305116-45305138 CCCGATGTCCAGAGTGGAGTTGG + Intergenic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1024624973 7:51199158-51199180 CCAGCAGGCCACAGTGGAGAGGG - Intronic
1025209752 7:57013802-57013824 CCTGGAGCCCTGAGAGGAGAGGG - Intergenic
1025263370 7:57437639-57437661 CGAGGTGCCCAAGGTGGAGAGGG - Intergenic
1025662201 7:63563049-63563071 CCTGGAGCCCTGAGAGGAGAGGG + Intergenic
1026661496 7:72306801-72306823 CCAGGTGCCCACGGTGGTCAGGG - Intronic
1026904494 7:74055104-74055126 CGAAGTGCTCAGAGAGGAGAGGG + Intronic
1026941199 7:74289157-74289179 CCAGGTGCCCAGCGCGGAGGTGG + Intergenic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1026998600 7:74635947-74635969 CAAGGTGCACAGGGTGCAGAGGG - Intergenic
1028595784 7:92545546-92545568 CGATGTGCCCAGATTGCAGATGG - Intergenic
1028796567 7:94908862-94908884 CCAGGAGCCGAGTTTGGAGACGG + Intronic
1029661699 7:101966680-101966702 CCAGGTGCCCCGACAGGTGAGGG + Intronic
1030073788 7:105719705-105719727 CCTGGAGCCCACAGTGGAAATGG + Intronic
1033246438 7:139720352-139720374 CCATGGGCCCAGGGTGGAGGTGG - Intronic
1033332691 7:140429327-140429349 CCAGATGCTAAGAGTGGAGCAGG - Intergenic
1033412345 7:141129722-141129744 ACAGGTGCCCAGGGTGGTTAAGG + Intronic
1033625877 7:143109150-143109172 CCATCTGCCTTGAGTGGAGAGGG - Intergenic
1034460005 7:151192946-151192968 CCAGGTGTGGGGAGTGGAGACGG - Intronic
1034904191 7:154929574-154929596 ACAGGTGCCTAGAATGAAGAGGG - Intronic
1035261653 7:157665459-157665481 CCAGCTCCTCAGAGTGGGGAGGG - Intronic
1036642469 8:10592940-10592962 CCTGCTGTCCAGGGTGGAGAGGG - Intergenic
1037012430 8:13860005-13860027 ACATGTGCCCAGAGTGGTCAGGG - Intergenic
1037243746 8:16807069-16807091 CCAGGTGCCCAGAGTAGAAATGG + Intergenic
1037829228 8:22178166-22178188 CCAGGTGCCCTGGGTGCACACGG - Intronic
1038525224 8:28267470-28267492 CCAGGTACCCAGCATGGAGAGGG + Intergenic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1040912033 8:52529125-52529147 ACAGGTGACCATAGTGGAGGAGG + Intergenic
1041253248 8:55955164-55955186 CCAGGGGCCAAGACTGTAGAGGG - Intronic
1041270602 8:56105345-56105367 CCAGGTGCCGGGATTGCAGACGG - Intergenic
1043533083 8:81171836-81171858 CTAGGTGCCCAAAGTCCAGAGGG + Intergenic
1044818971 8:96143386-96143408 CCAGGAGCCAGGAGTGGGGAAGG - Exonic
1045051768 8:98333910-98333932 CCAGGTCTCCAGTGTGCAGATGG + Intergenic
1045439807 8:102198079-102198101 CCATGTGCCCTGCGTGGAGTGGG - Intergenic
1045502535 8:102754290-102754312 GCAGAGGCCCAGAGCGGAGATGG + Intergenic
1045505169 8:102773153-102773175 GCAGGTTCCCAAAGTGGAGCAGG + Intergenic
1047220428 8:122914254-122914276 CCAGGCAGCCTGAGTGGAGATGG + Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048693111 8:136989738-136989760 CTAGGTGCCCAAAGTCCAGAGGG + Intergenic
1049038326 8:140094063-140094085 CCTGGTAGTCAGAGTGGAGATGG - Intronic
1049053412 8:140216728-140216750 CTAGCAGGCCAGAGTGGAGAGGG - Intronic
1049279719 8:141738112-141738134 CCAGGAGCCCCGGGGGGAGATGG + Intergenic
1049279737 8:141738171-141738193 CCAGGAGCCCCGGGGGGAGACGG + Intergenic
1049615895 8:143575731-143575753 CCAGCTGCCCTGGGTGGGGAAGG + Intronic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1049964389 9:765328-765350 ACATGTGCCCAAAGTGGACAGGG - Intergenic
1049976112 9:862236-862258 CGAGGTGCCGGGAGTGCAGACGG - Intronic
1051004687 9:12329279-12329301 CCAGGTGTACAGAGTGGACCAGG + Intergenic
1052356651 9:27511900-27511922 TCAGGTGCCCAGGAAGGAGAGGG - Intronic
1054810384 9:69429475-69429497 CCAGGTGCCCTGGGGGGAAAGGG - Exonic
1055704548 9:78983140-78983162 AGAGGTGCACAGTGTGGAGAAGG - Intergenic
1056803341 9:89709166-89709188 CCAGGTCCCAAGAGTTGACAAGG + Intergenic
1057123950 9:92601663-92601685 CCATGTGCCCACAGAGGAGTGGG + Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1058175919 9:101737248-101737270 CCTGGTGCGTGGAGTGGAGATGG - Intronic
1058244307 9:102604005-102604027 CGAGGTGCCAGGAGTGCAGACGG - Intergenic
1059438630 9:114290476-114290498 CCAGGTGCCAGGGGAGGAGATGG - Intronic
1060055321 9:120408233-120408255 CCACAAGGCCAGAGTGGAGAGGG + Intronic
1060189732 9:121584531-121584553 CCAAGTGCCCAGGGAGGACAGGG + Intronic
1060482403 9:124024381-124024403 CCAGGTGCCCTGAATGCTGATGG + Intronic
1060516702 9:124270401-124270423 CCAGGTCCCCAGAGTGGGAGGGG + Intronic
1060789259 9:126474849-126474871 CAAGGAGGCCAGAGTGGTGAGGG - Intronic
1061077469 9:128350389-128350411 GCAGGTGCCCAGGGTGGGGTAGG + Intronic
1061195188 9:129103521-129103543 ACAGAGGCCCAGAGTGGGGAAGG - Intronic
1061202832 9:129147351-129147373 GCAGGTGAGCAGAGTGGTGAGGG - Intronic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1061485355 9:130917827-130917849 CCAGGTGCGCAGGGCTGAGATGG + Intronic
1061533892 9:131235742-131235764 CCACCTGCCCAGGGAGGAGATGG + Intergenic
1061680247 9:132239517-132239539 CCAGTTGCCCAGAGAGGGAAGGG - Intronic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1062036179 9:134383609-134383631 CCTGGTTCCCAGAGTGGGGCGGG - Intronic
1062309559 9:135928677-135928699 CCAGGTCCCCAGAGGGGAAGGGG + Intergenic
1062378066 9:136273830-136273852 GCAGGTGCCAAGCCTGGAGATGG + Intergenic
1062561343 9:137143442-137143464 ACTGGTGCCCAGAGAGGCGAAGG - Intronic
1203562514 Un_KI270744v1:71036-71058 CGAGGTGCCGAGATTGCAGACGG + Intergenic
1186192020 X:7075713-7075735 TCAGGTGCCCAGAGAGGGCAGGG + Intronic
1186206382 X:7204942-7204964 CCATGGTCTCAGAGTGGAGAAGG - Intergenic
1186730370 X:12403270-12403292 CCATGTGCCAAAAGTGGAGCAGG - Intronic
1187103448 X:16218201-16218223 CCATCTGCCTTGAGTGGAGAGGG + Intergenic
1187877670 X:23817413-23817435 ACTGATGCTCAGAGTGGAGAGGG + Intergenic
1189422234 X:40866443-40866465 CCATGTGGCCAAAGTAGAGATGG - Intergenic
1189882246 X:45504614-45504636 CCAGGTGCCGGGATTGCAGACGG - Intergenic
1191013880 X:55789712-55789734 CCATCTGCCTTGAGTGGAGAGGG + Intergenic
1192509644 X:71714238-71714260 CCAGGTGCCCCGCAGGGAGAGGG + Intergenic
1192517053 X:71767315-71767337 CCAGGTGCCCCGCAGGGAGAGGG - Intergenic
1194100144 X:89693841-89693863 GCAGGTTCCCAGGCTGGAGAGGG - Intergenic
1194642362 X:96417627-96417649 CCTGGTGTCCAGACTGTAGATGG + Intergenic
1196932236 X:120693713-120693735 CCAGGTTTCCATAGTGGAAATGG + Intergenic
1196980909 X:121212844-121212866 CCAGCTGTCCAGAATGGAGGAGG + Intergenic
1197141436 X:123121764-123121786 TCAGGTGCCCAGGGTGGGGGTGG + Intergenic
1197473618 X:126892970-126892992 CCAGGTTCTCACAGTGAAGATGG + Intergenic
1197757114 X:130003089-130003111 CCAGGAGACCAGTGTGGAGGTGG - Intronic
1198028411 X:132731370-132731392 CCTGAGGGCCAGAGTGGAGATGG + Intronic
1200171041 X:154074988-154075010 CCAAGAGCCCAGTGAGGAGAAGG + Intronic
1200237183 X:154473295-154473317 CCAGGTGCTCAGAGAGAATAGGG - Exonic
1200453143 Y:3355200-3355222 GCAGGTTCCCAGGCTGGAGAGGG - Intergenic
1200852209 Y:7894900-7894922 CCAGGTGCTCAGAGAAGAAAAGG - Intergenic
1202095291 Y:21243331-21243353 CCAGGTCCCCAGATTTGAGCGGG + Intergenic