ID: 1026980401

View in Genome Browser
Species Human (GRCh38)
Location 7:74523427-74523449
Sequence ACTCGACCTCAGGCCGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026980398_1026980401 21 Left 1026980398 7:74523383-74523405 CCTGTCTCTATTTTTTTAAAAAA 0: 11
1: 75
2: 232
3: 806
4: 3573
Right 1026980401 7:74523427-74523449 ACTCGACCTCAGGCCGGACTTGG 0: 1
1: 0
2: 0
3: 0
4: 48
1026980397_1026980401 22 Left 1026980397 7:74523382-74523404 CCCTGTCTCTATTTTTTTAAAAA 0: 13
1: 83
2: 275
3: 795
4: 3579
Right 1026980401 7:74523427-74523449 ACTCGACCTCAGGCCGGACTTGG 0: 1
1: 0
2: 0
3: 0
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026980401 Original CRISPR ACTCGACCTCAGGCCGGACT TGG Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
915065860 1:153223284-153223306 TCTCCAACTCAGGCCAGACTGGG - Intergenic
915066539 1:153229499-153229521 TCTCCAACTCAGGCCAGACTGGG - Intergenic
1072144288 10:92620368-92620390 ACTATACCTCTGGCCGGACGCGG - Intronic
1075786372 10:125052817-125052839 ACTGGATCTCAGGCTGGAATTGG + Intronic
1076706752 10:132306539-132306561 ATACGACCTCAGGCCGGCGTTGG - Intronic
1076707300 10:132308689-132308711 ACGCGGTCTCAGGCCGGACGGGG - Intronic
1078127831 11:8585617-8585639 AATGGACCTCAGGCAGGGCTTGG + Intronic
1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG + Intronic
1081803082 11:45872955-45872977 ACTGGTCCTCAGGCAGGGCTGGG - Intronic
1090256605 11:125288735-125288757 ACTGGTCCTCAGGCCACACTTGG - Intronic
1091726912 12:2852769-2852791 TCCCGACCTCAGGCCCAACTCGG - Intronic
1092605270 12:10111711-10111733 ACTCGCCCTCGGGGCGGCCTGGG - Intergenic
1092882763 12:12900662-12900684 TCCCGACCTCAGGCCCGCCTCGG - Intronic
1102419849 12:112794851-112794873 TCTGTACCTCAGGCTGGACTGGG - Intronic
1105365733 13:19762819-19762841 ACTCAACCTAAGGCCGGGCACGG + Intronic
1117157100 14:52951466-52951488 TCTAGAGCTCAGGCTGGACTGGG + Intronic
1119223570 14:72927639-72927661 ACACCACCTCAGGCCGGGCGCGG - Intronic
1121305453 14:92903838-92903860 ACTCGCCTTCAGGCTGGTCTTGG + Intergenic
1129290686 15:74564889-74564911 ACTAGACTTCAGGCCAGACATGG - Intronic
1139729825 16:68933668-68933690 ATTCCTCCTCAGGCCTGACTCGG + Intronic
1151880637 17:76892531-76892553 ACTGGACCTCAGGGTGGCCTTGG - Intronic
1157351883 18:46895378-46895400 AATCTACCTCAGGACGGACACGG + Intronic
1160563868 18:79775003-79775025 AGTCGAACTCAGGCAGGAGTGGG + Intergenic
1163668214 19:18612907-18612929 ACTCCAGCTCAGGCCGGGCACGG - Exonic
1168269080 19:55239967-55239989 CCTAGCCCTCAGGCCGGCCTGGG + Intronic
929147045 2:38715721-38715743 ACTCGATTGCAGGCCGGACACGG - Intronic
938898576 2:135777594-135777616 ACTCCACCTCAGGCCAGGCATGG + Intronic
942449197 2:176098676-176098698 CCTAGTCCTCTGGCCGGACTAGG + Intergenic
942877487 2:180818852-180818874 ACTTAACCTCAGGCCGGGCGCGG + Intergenic
947615103 2:231550969-231550991 ACTTGAGCTCAGGCCAGCCTGGG + Intergenic
1174256328 20:49258319-49258341 TCCCGACCTCAGGCCTGCCTCGG + Intronic
1183784876 22:40023498-40023520 ACTCCACTTCAGTCAGGACTCGG - Intronic
954305636 3:49723942-49723964 CCCCGAACTCAGGCCGGACCCGG + Exonic
969929903 4:10620810-10620832 ACTCTACCTCAGGCTGGGCGCGG + Intronic
975590126 4:75991296-75991318 TCCCGACCTCAGGCCCGCCTTGG - Intergenic
982592944 4:157338365-157338387 ACTGGAACCCAGGCCAGACTGGG - Intronic
992144498 5:73831979-73832001 ACTAAACTTCAGGCCGGACATGG - Intronic
1001134416 5:169090517-169090539 ACCCCACCTCAGGCTGGAATAGG + Intronic
1002945961 6:1760880-1760902 ACTTGACCTCACCCGGGACTGGG + Intronic
1006194562 6:32230745-32230767 ACTCCGCCTCAGGCCGGGCGTGG + Intergenic
1006558908 6:34891915-34891937 ACTTGACCTGAGGCCGGGCAAGG - Intronic
1006925009 6:37649249-37649271 GCTCCACCTCCGGCGGGACTGGG + Exonic
1023957428 7:44898006-44898028 ACTTGAGCTCAGGCCAGCCTGGG + Intergenic
1026980401 7:74523427-74523449 ACTCGACCTCAGGCCGGACTTGG + Intronic
1030782170 7:113614826-113614848 TCCCGACCTCAGGCCTGCCTCGG - Intergenic
1033096976 7:138440848-138440870 ACCTGACCTCAGCCCTGACTTGG + Intergenic
1040455363 8:47592620-47592642 ACTAGACCAGAGGCCGAACTCGG - Intronic
1185773459 X:2783682-2783704 ACTACACCTCAGGCCGGGCGTGG + Intronic