ID: 1026981267

View in Genome Browser
Species Human (GRCh38)
Location 7:74528128-74528150
Sequence GTGAATATACAAATGGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026981267_1026981272 26 Left 1026981267 7:74528128-74528150 CCTTTAGCCATTTGTATATTCAC 0: 1
1: 0
2: 3
3: 52
4: 289
Right 1026981272 7:74528177-74528199 CAGCCCCATTGAGGTCGCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 96
1026981267_1026981269 17 Left 1026981267 7:74528128-74528150 CCTTTAGCCATTTGTATATTCAC 0: 1
1: 0
2: 3
3: 52
4: 289
Right 1026981269 7:74528168-74528190 GTGTGTGCCCAGCCCCATTGAGG 0: 1
1: 0
2: 5
3: 27
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026981267 Original CRISPR GTGAATATACAAATGGCTAA AGG (reversed) Intronic
902066224 1:13690420-13690442 CTGAGTACACAAATGTCTAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905510064 1:38512144-38512166 GTAAACAAACAAATGGATAACGG + Intergenic
906442768 1:45863706-45863728 GTAAATATAGCAATAGCTAAAGG - Intronic
906921057 1:50064845-50064867 AGAAATATACAAAAGGCTAAAGG - Intronic
909561989 1:77017387-77017409 GTGCAAATACAAATGCCTAGGGG + Intronic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
911869709 1:103080533-103080555 GAAGACATACAAATGGCTAACGG + Intronic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
916352511 1:163867290-163867312 GTTAATATACAAATAGATATTGG + Intergenic
916405373 1:164492800-164492822 GTGAATGTCCAAATGACTCAAGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917784514 1:178439320-178439342 ATAAATGTACAAATGCCTAAGGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918749492 1:188255084-188255106 GAAGATATACAAATGGCCAATGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919591053 1:199503162-199503184 GTGGTATTACAAATGGCTAATGG + Intergenic
921688038 1:218113022-218113044 GTGAAAATTGAACTGGCTAAGGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1065374007 10:25017907-25017929 GTGACTATCCACTTGGCTAATGG - Intronic
1065501684 10:26389587-26389609 GTCCCTATACAAATGGCCAATGG + Intergenic
1066687379 10:37993810-37993832 TGGAATATATAAATGGCTATGGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067690844 10:48501073-48501095 GTGAAAAGACAAATGGCAAAAGG + Intronic
1067730516 10:48807207-48807229 GGGAATGAACAAATGGGTAATGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1073938425 10:108663438-108663460 GTGAACATTTAAATAGCTAAAGG - Intergenic
1074167795 10:110900872-110900894 GTAAATATTCAAATGACTGAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075271506 10:121055914-121055936 TTGAAAATATAAATGCCTAATGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077536152 11:3125404-3125426 CAGGACATACAAATGGCTAATGG + Intronic
1078962158 11:16289133-16289155 TTAACTATACAAATAGCTAATGG - Intronic
1079616329 11:22497893-22497915 ATGAATAAATAAATGGCTAGGGG + Intergenic
1080023747 11:27592250-27592272 GTGAATGTACAAGGGGGTAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081240813 11:40704437-40704459 GTGATTATTTAAATGACTAAAGG - Intronic
1085021151 11:73209309-73209331 CTTAATAGAAAAATGGCTAAAGG + Intergenic
1086497173 11:87416307-87416329 GAATATATACAAATGGCTAATGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087323212 11:96687734-96687756 GTTAATATACAAAGTGCTTAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088184868 11:107155631-107155653 GTGAGTATTCATATGGCAAAAGG + Intergenic
1088311629 11:108466654-108466676 GTGAATCTACAAGTGGCACATGG - Intronic
1089906854 11:122048918-122048940 GTGCACATACAAAAGCCTAAGGG + Intergenic
1091153146 11:133348024-133348046 ATGCATATACAACTGGCTGAAGG - Intronic
1093118568 12:15240925-15240947 GTGAATATATAAATGAATTAAGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095223462 12:39648612-39648634 GTTACTATACTAATGTCTAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096303795 12:50456542-50456564 GTTAATATAAAAATTGCAAAAGG - Intronic
1096313280 12:50541076-50541098 GAGAATATAGAAAAAGCTAAGGG + Intronic
1097807184 12:63978984-63979006 GATGATATACAAATGGCAAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1099170345 12:79356311-79356333 GGGTGTAAACAAATGGCTAATGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100133285 12:91522322-91522344 GTGAAGATAGAAATGTGTAAAGG + Intergenic
1102489404 12:113280366-113280388 GTGAAGATACAGATGGGTGATGG - Intronic
1102624455 12:114223812-114223834 TAAAACATACAAATGGCTAACGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106201257 13:27539112-27539134 GTGAATCTACAAAGGGCTCTGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1107242631 13:38255123-38255145 GTGAACCTTCAGATGGCTAAGGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109376822 13:61506280-61506302 GAAAACATACAAATGGCTAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110164036 13:72415958-72415980 GTGGATAAACAAATGATTAAAGG - Intergenic
1111344863 13:86938401-86938423 CTGACTATCCAAATGGCTATTGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1113282354 13:108802848-108802870 GAAGATATACAATTGGCTAATGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1120542017 14:85762360-85762382 GTGAATATCCAAACGGCCCAAGG + Intergenic
1120976446 14:90253331-90253353 GTTAATATACAAATTGCCATTGG - Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1125350536 15:38762437-38762459 GTGAATACAAAAAAGGTTAAAGG - Intergenic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1128038416 15:64547621-64547643 GTGGCTTTACAAATGGCTAGAGG - Intronic
1135789659 16:25382002-25382024 GAGGATATCCAAATGGCCAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1139100323 16:63759070-63759092 GTGAATATATAAATTGCTTTGGG - Intergenic
1139726039 16:68899338-68899360 GTGAATATAGAAATCAGTAAGGG - Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1147532677 17:41294413-41294435 GGAAATATCCAAATGGCTATGGG - Intergenic
1147892307 17:43726023-43726045 GTGAAGACTCAAATGGCTAGAGG - Intergenic
1149653043 17:58289779-58289801 GTGATTTTACAAATGCTTAATGG + Intergenic
1150499193 17:65633888-65633910 GTGAGTATAGAAATGGCTACTGG - Intronic
1150848128 17:68679939-68679961 GTGGATGGACAAATGGGTAATGG - Intergenic
1152658517 17:81531002-81531024 GTCCATATACAAATGCCTAAAGG - Intronic
1153173389 18:2342613-2342635 GTCAATATATGAATAGCTAATGG - Intergenic
1153853440 18:9119704-9119726 GGAAACATACAAATGGCTAAAGG - Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155124701 18:22861158-22861180 GAAGACATACAAATGGCTAATGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156610719 18:38720944-38720966 GTGAATATAACAATGGCTCCAGG + Intergenic
1156784749 18:40897081-40897103 GAGTATATACAGATAGCTAATGG + Intergenic
1156937474 18:42727941-42727963 ATAAAAAGACAAATGGCTAAGGG - Intergenic
1157053471 18:44197704-44197726 TTGAAAATACAAATATCTAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157254821 18:46129497-46129519 GCTAATACACAAATGGCAAAAGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161424829 19:4197729-4197751 GCGAATAAACAAATGGGTGAAGG + Intronic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1163093706 19:15039962-15039984 GTATATTTTCAAATGGCTAAAGG + Intergenic
925277431 2:2660339-2660361 GTGACTTTGGAAATGGCTAATGG - Intergenic
927987506 2:27422821-27422843 GAAGATATACAAATGGCTAACGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930482798 2:51970512-51970534 GTGAATAGACAAATACATAATGG + Intergenic
931666618 2:64613946-64613968 GACAAAATAAAAATGGCTAATGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
934971187 2:98765781-98765803 GTAAATTTAAAAATGGTTAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940644663 2:156378126-156378148 ATGAACATAAAAATGGCTACAGG - Intergenic
940874970 2:158889251-158889273 GAGGATATACAGATGGTTAAAGG + Intergenic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
942214598 2:173706110-173706132 GTGAATATTAAAATCCCTAACGG + Intergenic
942855081 2:180535795-180535817 GTGTATATACATATGGCTTCAGG - Intergenic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943753355 2:191532953-191532975 TTGAATATATATATAGCTAATGG - Intergenic
944199242 2:197087980-197088002 GGTAATATACAAATGACAAATGG + Intronic
944441646 2:199749298-199749320 GGGAATAAATACATGGCTAAAGG + Intergenic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945593639 2:211765640-211765662 TGGAATAAACAAATGTCTAAGGG - Intronic
946693536 2:222329074-222329096 GATGATATACAAATGGCTAACGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175452494 20:59081572-59081594 GTTAATTTAAAAATGGTTAATGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177121573 21:17143326-17143348 GTGAATATCCAAATGGCTGCTGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177806621 21:25881334-25881356 AATAATATACAACTGGCTAAGGG + Exonic
1178011257 21:28289698-28289720 GTAAATATACACATTGCAAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181979431 22:26755574-26755596 GTGAATGTAGACATGGCTCAAGG - Intergenic
949690912 3:6637899-6637921 GTGAATAAATAAATGACTGAAGG + Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950999384 3:17540118-17540140 GAAAATATACAAATGGCAATTGG - Intronic
951707792 3:25560904-25560926 GTGAATAAACAAATTGGTATAGG + Intronic
951863738 3:27283783-27283805 TGAAATATACAAATGGCTAGAGG + Intronic
952494104 3:33901055-33901077 GTAAATATAAAAATGACTATAGG - Intergenic
952690332 3:36197798-36197820 GTACATATAAAAATGGCAAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954089052 3:48270494-48270516 GAGGAGAGACAAATGGCTAAAGG - Exonic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956105309 3:65811356-65811378 GAGAATCTAAAAATGTCTAATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959649688 3:108739624-108739646 GTTATTATACATATGGCTTAGGG - Intergenic
960344342 3:116513958-116513980 CTGAAAAATCAAATGGCTAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
963953439 3:151227579-151227601 GTGATTATGCAAATGGATCATGG + Intronic
964197802 3:154084795-154084817 GTGAACATACAAGTTGGTAAAGG + Intergenic
967417115 3:189231445-189231467 GTGAATATACAAAGTGTTTAAGG + Intronic
969236675 4:5870273-5870295 GTGAATACATAAACGGGTAAGGG - Intronic
969587993 4:8105625-8105647 GTGAATCTCCAAATGGCCCAGGG + Intronic
970162941 4:13207720-13207742 GTAAGTAAACAAATTGCTAATGG + Intergenic
970173868 4:13317123-13317145 GAAGATATACAAATGGCCAATGG - Intergenic
970465593 4:16319579-16319601 GTCAGAAGACAAATGGCTAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971420383 4:26468817-26468839 GAGAGAACACAAATGGCTAAGGG - Intergenic
971596159 4:28531628-28531650 ATAAATATACTAATGGCAAAAGG + Intergenic
971745516 4:30574727-30574749 GTGAATATCAAGATTGCTAAAGG + Intergenic
971829303 4:31670469-31670491 GCTAACATAGAAATGGCTAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974691522 4:65303561-65303583 GTGAATCGACATATGGCTCAGGG + Intergenic
974900061 4:67985516-67985538 GTGACTATACAAAAGGCAAAGGG + Intergenic
975846884 4:78534485-78534507 GTGAATACACAACTGGCACAGGG - Intronic
977486813 4:97659243-97659265 TTACATATATAAATGGCTAATGG - Intronic
978300771 4:107267508-107267530 TTAGATATACAAAAGGCTAATGG - Intronic
978819354 4:112947681-112947703 GTGATTATATAAATTGCTGAAGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981342909 4:143642981-143643003 GAAGATATACAAATGGCCAACGG + Intronic
982117988 4:152113621-152113643 GGGAATAAACAAGTGCCTAAGGG + Intergenic
982279686 4:153670123-153670145 GAAAATATATAAATGGCCAAGGG - Intergenic
983267797 4:165525449-165525471 GTGAAGACAAAAGTGGCTAATGG - Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
984281117 4:177672013-177672035 GTGACTATAAAAATGGTTGAAGG - Intergenic
986458191 5:7941476-7941498 GTTGATATAAAAGTGGCTAAAGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986878366 5:12138875-12138897 GTGAACATTCTAAGGGCTAAGGG + Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
990174634 5:53093341-53093363 GTGCAGAGACAAGTGGCTAATGG - Exonic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991207280 5:64064241-64064263 GACAATATACAAATGGCGAATGG - Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992442447 5:76808654-76808676 GTGAATATTCAAAAGGCTAACGG - Intergenic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993258885 5:85631679-85631701 GTGAGTATAAAAATGTGTAATGG + Intergenic
993263043 5:85685503-85685525 GTAAATATACTAAAGGCTACTGG - Intergenic
994012901 5:94928173-94928195 ATGAATTTACCAATGGGTAAAGG - Intronic
995022135 5:107379030-107379052 CTGCATATATAAATAGCTAAAGG + Exonic
996140985 5:119908843-119908865 GTGAATTTATAAATGGCTTTTGG + Intergenic
996166734 5:120232980-120233002 TTGAATCTACAAATTGCTTAGGG + Intergenic
996618614 5:125472236-125472258 GTGAATATAGAGGTGGTTAATGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997397002 5:133569485-133569507 GTCAATAAACAAATGAGTAAAGG - Intronic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
998679442 5:144450163-144450185 GTGACCATACAAATGGCCACCGG + Intronic
998815011 5:146004987-146005009 GTGTTTATATAAATGGATAAAGG + Intronic
998979210 5:147682240-147682262 GTGAATAGAAAAATGGCAAGAGG + Intronic
999041782 5:148421735-148421757 GTGAAGATACAAATGATTCATGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002629761 5:180563903-180563925 TTGAATTTACAGATGGCTCATGG + Intronic
1202774109 5_GL000208v1_random:47721-47743 GTGAATCTGCAAATGGCTTTTGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005815408 6:29547918-29547940 GAGAATATACTAAAGGTTAAGGG + Intergenic
1007705645 6:43789427-43789449 CTTAATATACACATGGCTAGTGG + Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009903150 6:69833977-69833999 CTGAATATATAACTGCCTAAAGG - Intergenic
1010925214 6:81736452-81736474 GACTATATAAAAATGGCTAAGGG + Intronic
1011038485 6:83003253-83003275 GTGAGAATACAAATGGCTTGGGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012181129 6:96154308-96154330 TTGACTATATAAATGACTAAAGG - Intronic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012742460 6:103035743-103035765 GTATATATACAAATGACCAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020739307 7:11993050-11993072 GTAAATAAACAGATGGCTGATGG + Intergenic
1020976443 7:15012852-15012874 GTGAATATTAACATGACTAAGGG - Intergenic
1021598112 7:22338531-22338553 GAGAATACACAAATGACTAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029106633 7:98182447-98182469 GGAAATATACAAATGGCAATAGG + Intronic
1031053882 7:116972979-116973001 GTGAATAAACAAATGGGTGAGGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031756761 7:125653935-125653957 GAAGATATACAAATGGCCAACGG - Intergenic
1031785029 7:126019130-126019152 GAGAATATACAATTGTCTACAGG - Intergenic
1031794543 7:126155538-126155560 GTGAATATACAAATGAGTTAAGG + Intergenic
1032984185 7:137318613-137318635 GTGAATGAACAAATGACTACAGG + Intronic
1033433613 7:141312181-141312203 GTGAATATCCAACTACCTAATGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036425176 8:8638752-8638774 GTGTATACACAAAAGGCTGAAGG + Intergenic
1036507714 8:9370513-9370535 GGGAATAGACAAATGGCGAAGGG + Intergenic
1036713458 8:11098745-11098767 GTGAATAGACTAATAGTTAAGGG - Intronic
1036920020 8:12843555-12843577 GAGAAAAGACAAATTGCTAATGG - Intergenic
1039187536 8:34933999-34934021 TTGCCTATACAAATGGCTATGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040788734 8:51199064-51199086 CTGAAAATACAAATGGCTGGGGG - Intergenic
1040792268 8:51245975-51245997 GTTAAGATAAAAATGGCTTAGGG + Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041328665 8:56698358-56698380 TTTAATATACACATGGCTAGTGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042251972 8:66765334-66765356 GAAAATATACAAATGGCCACAGG - Intronic
1042749384 8:72141401-72141423 GGGAATATATAGATGGCTTAGGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043548897 8:81346241-81346263 GAAGATATACAAATGGCTAATGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045369757 8:101511234-101511256 AAGAATATACAAGTGACTAAAGG + Intronic
1045564970 8:103305063-103305085 GTGGAAAAACAAATGGCTACTGG + Intronic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046156945 8:110304581-110304603 TTGAATCTACAAATGGCTTTGGG - Intergenic
1047005711 8:120617926-120617948 GTGAAGGTACAACTGCCTAAGGG + Intronic
1047044061 8:121032098-121032120 GTCAAAGTACAGATGGCTAACGG + Intergenic
1048715712 8:137266294-137266316 TTGAATTGACAAATGGCTTAAGG + Intergenic
1050857735 9:10382435-10382457 GTGGAAATAAAAATGGCTAATGG - Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051192846 9:14533517-14533539 GTGAATATAAAAATACCCAAAGG - Intergenic
1051224943 9:14889418-14889440 GAGAACACACAAATGGCTAAGGG - Intronic
1052565308 9:30142435-30142457 GTGAATATATTAGTTGCTAAGGG - Intergenic
1052634757 9:31087774-31087796 TTGAATATACAAATTGCTTTGGG + Intergenic
1055288082 9:74752665-74752687 GTAGATATAAAAATTGCTAAAGG - Intronic
1055423312 9:76166800-76166822 GTTGATATAGAAATGGCTAGAGG - Intronic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057506640 9:95639426-95639448 GAACATATACAAATGGCCAATGG + Intergenic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058270368 9:102965676-102965698 GAAAACACACAAATGGCTAACGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1059979477 9:119754413-119754435 GAGGATATACAAATGGCCACAGG - Intergenic
1060097172 9:120801803-120801825 GTTAATATCCAAATAGATAAGGG - Intergenic
1060156420 9:121323219-121323241 GTGAATATTCCATTGGGTAATGG - Intronic
1060253890 9:122008441-122008463 GAAAACATACAAATGGCCAATGG + Intronic
1185884702 X:3772067-3772089 CTGAATTTACAAATGACTCAAGG + Intergenic
1187808428 X:23147662-23147684 GAAGACATACAAATGGCTAACGG + Intergenic
1188929790 X:36093534-36093556 GAAAACATACAAATGGCAAATGG - Intronic
1189079608 X:37957163-37957185 GCGAATATACAAATATATAAAGG - Intronic
1191046340 X:56141811-56141833 GTGATGATACAAATGACCAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193366945 X:80645803-80645825 GTGATTATTCAAATAACTAAAGG + Intergenic
1194528656 X:95014833-95014855 GAGAATATACATATGAGTAATGG - Intergenic
1195614431 X:106901413-106901435 GTGAAGATTCAAAGAGCTAATGG + Intronic
1196695633 X:118608335-118608357 ATCAATAAACAAATTGCTAAAGG + Exonic
1198610787 X:138397449-138397471 TTCAATATACAATTGACTAAGGG + Intergenic
1199034807 X:143037401-143037423 GTTATTATAGAAATGGCTCACGG - Intergenic
1199084598 X:143614311-143614333 GTGTATATATAAATAGATAAAGG + Intergenic
1199255533 X:145714959-145714981 GTGTATATAGAAATGAATAAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic