ID: 1026982360

View in Genome Browser
Species Human (GRCh38)
Location 7:74534270-74534292
Sequence GGAAAGCATGGGCCAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026982360_1026982367 1 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982367 7:74534294-74534316 TAACTGTGCAAAAATGGTTTGGG No data
1026982360_1026982366 0 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982366 7:74534293-74534315 CTAACTGTGCAAAAATGGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 147
1026982360_1026982368 6 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982368 7:74534299-74534321 GTGCAAAAATGGTTTGGGATAGG No data
1026982360_1026982363 -5 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982363 7:74534288-74534310 TTTCCCTAACTGTGCAAAAATGG 0: 1
1: 0
2: 1
3: 29
4: 247
1026982360_1026982372 20 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982372 7:74534313-74534335 TGGGATAGGCTGGGTGCCGTGGG No data
1026982360_1026982370 11 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982370 7:74534304-74534326 AAAATGGTTTGGGATAGGCTGGG No data
1026982360_1026982371 19 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982371 7:74534312-74534334 TTGGGATAGGCTGGGTGCCGTGG No data
1026982360_1026982369 10 Left 1026982360 7:74534270-74534292 CCAGGGGTTGGCCCATGCTTTCC 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1026982369 7:74534303-74534325 AAAAATGGTTTGGGATAGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026982360 Original CRISPR GGAAAGCATGGGCCAACCCC TGG (reversed) Intronic
901789651 1:11647589-11647611 CCAAAGCCTGGGCCAACCTCTGG + Intergenic
902129886 1:14251059-14251081 GGAAAGAAAGGGCCTAACCCTGG + Intergenic
902256147 1:15189873-15189895 GGATAGCAGGGGCTAACCCAAGG + Intronic
902945320 1:19832314-19832336 GGAAAGTATGGGCCAGGCGCGGG + Intergenic
903017611 1:20371445-20371467 GGAAGGCAGGTGCCCACCCCAGG + Intergenic
903068490 1:20714831-20714853 GGAAGGCCTGGGCCAAGCACTGG + Intronic
904199033 1:28807366-28807388 GGAAATCCTGGGCTAACCCAGGG - Intergenic
904942907 1:34177375-34177397 GGACAGCATGGGCTGAGCCCAGG + Intronic
907527434 1:55062155-55062177 GCAAGGCATGTGCCAAGCCCTGG + Intronic
908335425 1:63118266-63118288 GAAGAGCATAGGCCAAGCCCAGG + Intergenic
908544069 1:65147736-65147758 GGAGCGCATCCGCCAACCCCGGG + Intronic
912525962 1:110282712-110282734 GCCAAGCAAGGGCCATCCCCTGG - Intronic
916760575 1:167812623-167812645 GGAAAGCATGGCTCATCCCAAGG + Intronic
917235091 1:172883352-172883374 GGCAAGAATGGGCCAACTTCTGG + Intergenic
918230411 1:182525258-182525280 GGAAAGTATGGTCCATCCACAGG + Intronic
919732471 1:200922035-200922057 TGGGAGCATGGGCCAATCCCTGG - Intergenic
923208149 1:231778247-231778269 GGAAAGCAAGGCCCCGCCCCAGG + Intronic
923706351 1:236347909-236347931 GGGAACCACGGGGCAACCCCGGG - Intergenic
1063382886 10:5597261-5597283 GGAAAGGAAGGGCCCATCCCTGG + Intergenic
1065262407 10:23937424-23937446 GTAAAAGATGGGCCAACCACAGG - Intronic
1065303693 10:24348830-24348852 TGAATGCTTGGGCCAACCCTTGG - Intronic
1066433187 10:35372180-35372202 GGAAAGGATGGGGGAACTCCAGG + Intronic
1067015420 10:42754129-42754151 GGAAAGGTGGGGCCAGCCCCTGG + Intergenic
1069249159 10:66246136-66246158 GGAAAGTCAGGGCCAAGCCCAGG - Intronic
1069597875 10:69684308-69684330 GGAAAGCAAGGGCTATCCCCCGG - Intergenic
1073428478 10:103470901-103470923 GAAAAGCATGGGGCGAACCCGGG - Intergenic
1074420034 10:113300290-113300312 GGAAAACATGGGCAAAGGCCAGG + Intergenic
1074709899 10:116168633-116168655 GGAGAGGAAGGGCCAACCTCGGG + Intronic
1075105186 10:119535076-119535098 GGAAATCACGGCCCAAACCCAGG + Intronic
1075638921 10:124050451-124050473 ACAAAGCATGGGCCAGCCCTAGG - Intronic
1077286160 11:1766922-1766944 GGAAAGCACGTGATAACCCCAGG - Intergenic
1080168854 11:29274139-29274161 GGAAAGCTTTGGGTAACCCCAGG + Intergenic
1080416064 11:32070948-32070970 GGAAAATATTTGCCAACCCCTGG + Intronic
1081551793 11:44120397-44120419 GGACAGCATGGGCCCAAGCCAGG - Intronic
1084222160 11:67689122-67689144 GGCCAGCATGGGCAAATCCCCGG + Intergenic
1084502309 11:69542078-69542100 GGAAAGAATGGGCCATGCCCAGG - Intergenic
1085100500 11:73796363-73796385 GCAAAGCTGGGGCCAAGCCCAGG + Intronic
1085311424 11:75519179-75519201 GGAGAGCTTGGGCAGACCCCAGG - Intronic
1085336280 11:75699108-75699130 GTAAATCATGAGCCAAGCCCTGG + Intergenic
1092039052 12:5367361-5367383 GGAAAGGCTGGGGCATCCCCAGG - Intergenic
1095675874 12:44917519-44917541 GGGAATCATGGGCCCACCCTAGG - Intronic
1096567686 12:52495031-52495053 AGAAAACATTTGCCAACCCCTGG + Intergenic
1096855549 12:54479577-54479599 GTAAAGTATGGACCAACCACAGG + Intergenic
1099546439 12:83987364-83987386 GGAAAGCCAGGGCCATCACCAGG - Intergenic
1099719382 12:86341685-86341707 GGAGAGCCTGAGCCAACCCAGGG + Intronic
1103037093 12:117665413-117665435 GCAGAGCAGTGGCCAACCCCTGG + Intronic
1105826840 13:24130234-24130256 TGAAGCCATGGGCCAGCCCCTGG - Intronic
1107372504 13:39767991-39768013 GGACAGCATGTGGAAACCCCCGG - Intronic
1113093061 13:106635306-106635328 GGTAAAATTGGGCCAACCCCAGG - Intergenic
1113713657 13:112488588-112488610 GGAGCGCAGGGGCCACCCCCAGG + Intronic
1121270219 14:92632807-92632829 AGACAGCATGGGCAAACGCCTGG + Intronic
1123092108 14:105746467-105746489 GGCAAGCAGGGGGCAGCCCCTGG - Intergenic
1125159066 15:36622720-36622742 GGAAGTCATGGGCAGACCCCAGG + Intronic
1129412604 15:75358396-75358418 GGTAAGGAGGGGCCAGCCCCAGG - Intronic
1129851257 15:78795216-78795238 GGACAGCAGGGCCCAGCCCCTGG - Intronic
1131272000 15:90953249-90953271 GGTAAGCATGGCCAAGCCCCCGG - Exonic
1131355137 15:91738697-91738719 GGAAGCCATGTGCCAAGCCCAGG + Intergenic
1132959078 16:2612302-2612324 GGAAAGGCAGGGCCAAGCCCAGG + Intergenic
1132972138 16:2694277-2694299 GGAAAGGCAGGGCCAAGCCCAGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1135620192 16:23949260-23949282 TGAAAGAAAGGGCCAGCCCCTGG + Intronic
1137524578 16:49223594-49223616 GGAAGGCAACGGCCAAACCCAGG + Intergenic
1137653206 16:50137816-50137838 GGAAAACATGGACCAAAACCTGG - Intergenic
1141640191 16:85336328-85336350 GCAAAGTCTGGGCCATCCCCTGG - Intergenic
1141976446 16:87519349-87519371 GGGAGGAATGTGCCAACCCCCGG + Intergenic
1142714084 17:1738509-1738531 AGGCAGCAGGGGCCAACCCCTGG - Exonic
1143651715 17:8267424-8267446 GGAAGGCATCGGCCATCTCCCGG - Exonic
1144627457 17:16851635-16851657 TGGAAGCATGGCCCAACCCAGGG + Intergenic
1144662193 17:17078371-17078393 GGAAAGCAAGGGCAAAGTCCTGG + Intronic
1148527013 17:48348738-48348760 GGAAAGCAAGTGCCAAATCCAGG - Intronic
1148766924 17:50044979-50045001 GGAAAGCATCGGCCAAGACTTGG + Intergenic
1148856467 17:50581609-50581631 GGACAGCATGGGGCCAGCCCCGG - Intronic
1151316426 17:73325325-73325347 GAAAAGCATCAGCCAACCCTGGG - Intergenic
1151766518 17:76135976-76135998 GGACAGCAGGGGCCGAGCCCAGG + Intergenic
1151997723 17:77620819-77620841 GGGCTGCATGAGCCAACCCCAGG - Intergenic
1152428800 17:80236044-80236066 AGAAAACATTTGCCAACCCCAGG + Intronic
1155084236 18:22440886-22440908 GAATAGCTTGGGCCATCCCCTGG - Intergenic
1159958325 18:74535549-74535571 GGAAAGCATGGCCAGACCACAGG - Intronic
1161002543 19:1918052-1918074 GGAAAGCATGGGCCCAGCAATGG - Intronic
1161194401 19:2978057-2978079 GGAACGCATGGGAGAACCGCAGG + Intronic
1162852298 19:13440184-13440206 GGATAGCTTGAGCCAAGCCCAGG - Intronic
1163485762 19:17584604-17584626 GGAAAGAGTGGTCCCACCCCAGG + Intergenic
1163655186 19:18541784-18541806 GGAGGACATGGGACAACCCCCGG - Exonic
1163722506 19:18904943-18904965 ACAAAGCAGGGGCCATCCCCAGG - Intronic
1164051478 19:21587974-21587996 GGAATGCATAAGCCCACCCCAGG - Intergenic
1164372789 19:27656472-27656494 GGAAATACTTGGCCAACCCCAGG - Intergenic
1164740737 19:30573745-30573767 GGAAAACGTGGGCCAATCCTTGG + Intronic
1166977247 19:46611950-46611972 GGGAAGCCTGGCCCAATCCCAGG + Intergenic
1167207450 19:48112218-48112240 TGACAGCATGGACCAAACCCTGG + Intergenic
925016645 2:532369-532391 GGAAAGTATGGCCCATCCCCAGG + Intergenic
925161518 2:1687364-1687386 GGAAAGCATGGCCCAGGGCCTGG + Intronic
925846900 2:8042931-8042953 GGAAAGCATAGCACAGCCCCTGG + Intergenic
926118374 2:10227492-10227514 TAACAGCATGGCCCAACCCCAGG + Intergenic
931638509 2:64361657-64361679 GGAAAGCAAGGGGCTACCTCAGG - Intergenic
932501669 2:72187876-72187898 GCAAAGTTGGGGCCAACCCCAGG - Intronic
936013816 2:108942933-108942955 GGAAGGCATGGTCTAATCCCAGG - Intronic
937328633 2:121007682-121007704 GGATAGCATGGGCACACCCAGGG - Intergenic
937996565 2:127698809-127698831 GGAAAGCATGGACCAAAACAGGG + Intergenic
938935135 2:136120897-136120919 GGAAAGCATAGAAAAACCCCAGG - Intergenic
947032723 2:225816509-225816531 AGTTAGCTTGGGCCAACCCCAGG - Intergenic
947837276 2:233184771-233184793 GGCAAGCAGGGTCCAATCCCTGG + Intronic
947871682 2:233442157-233442179 GGAGAGCCTGGGCCACCCCCTGG + Intronic
1168813142 20:719425-719447 AGAGAGCAGGGGCCAACTCCTGG + Intergenic
1171242968 20:23586391-23586413 GGAAAGCATGGGCGAGGCACTGG - Intergenic
1172220802 20:33273499-33273521 GGGAAGCATGGGGCAACCACAGG - Intronic
1172838234 20:37886639-37886661 GGAAAGGATGGGGCTCCCCCCGG + Intergenic
1178432016 21:32525549-32525571 GGGCAGCAAGGGCCAACCCGAGG - Intergenic
1179921705 21:44510888-44510910 GGAAAGCCTCAGCCAGCCCCCGG - Intronic
1181853930 22:25769092-25769114 GGAAAAGATGGGGCAACCCCAGG + Exonic
1182098179 22:27639644-27639666 GCAAACCCTGGGCCAGCCCCAGG + Intergenic
1182270929 22:29152801-29152823 GGAACCCATGGGGCACCCCCAGG - Intronic
1183356143 22:37360715-37360737 GGAAAGCAGGGGCCAAAGACAGG + Intergenic
1183358367 22:37371210-37371232 GGAAAGCTAGTGCCATCCCCTGG - Exonic
1183932758 22:41245679-41245701 GGAAAGCATGGGGCAGTCACGGG + Exonic
949859744 3:8494514-8494536 GGAAAGCAGGGACCACCCCTAGG + Intergenic
950687560 3:14629315-14629337 GCAAAGCCTGGGGCAGCCCCTGG + Intergenic
951819878 3:26796329-26796351 GGAAAGCATGGGCAAGACACTGG - Intergenic
953759005 3:45672343-45672365 GGAAGGGATGGGCCAATCCCAGG - Intronic
956599205 3:71001177-71001199 GGAAAGGACAGGCCACCCCCTGG - Intronic
961313423 3:126018016-126018038 GGAAAGCATGAGGCAGGCCCTGG - Intronic
961509880 3:127394224-127394246 GGGAAGCAGGTGCCATCCCCGGG + Intergenic
962494622 3:135926760-135926782 TGGAAGCATGGGCCCACCTCAGG + Intergenic
964235223 3:154518032-154518054 GGAAGGAATGGGTTAACCCCTGG - Intergenic
966253295 3:177890993-177891015 TGAAAGCATTGGCCTACCCAGGG + Intergenic
966970139 3:185037995-185038017 GGAAAGTATGATCAAACCCCAGG - Intronic
967877163 3:194275427-194275449 GGACAGCATGAGCCAAGCCAAGG + Intergenic
968759376 4:2434125-2434147 GGCAGGCTTGGGCCAAGCCCAGG + Intronic
971547594 4:27906279-27906301 AGAAAGTATTTGCCAACCCCTGG + Intergenic
972883687 4:43458152-43458174 TGAATGCATGCGCCAACCTCAGG - Intergenic
973783952 4:54317915-54317937 GGAAAGCATAGGCCACAGCCTGG + Intergenic
974074597 4:57157167-57157189 GGAGAGCCTTGGCCAACCCGAGG + Intergenic
985646543 5:1087458-1087480 GGAAAGCCGGGCGCAACCCCAGG + Intronic
986523784 5:8650256-8650278 TGAAAGCAGGGGCCATTCCCAGG - Intergenic
986556666 5:9016793-9016815 GGACAGCATAGGGCAACACCTGG - Intergenic
991171590 5:63632901-63632923 GGAAAGCATGTCCAAAGCCCTGG - Intergenic
992494681 5:77281064-77281086 GGAATGCATGCGCAAGCCCCAGG + Intronic
1003690166 6:8346244-8346266 GGGAACCCTGGGCCAAGCCCAGG - Intergenic
1006682360 6:35806103-35806125 GGCAGGCAGGGGCCCACCCCGGG + Intronic
1007401219 6:41603628-41603650 AGAAAGCAGGGGCAAACCACAGG - Intergenic
1007768172 6:44173391-44173413 GCAAAGCATGGTCCCACCTCAGG + Intronic
1011454852 6:87537399-87537421 GGAAACCACAGGCCAAACCCAGG - Intronic
1017442585 6:154477702-154477724 GCAAAGCTTGGGCCCACCCAAGG + Intronic
1017733213 6:157336893-157336915 AGAAAATATGGGCCAAGCCCAGG - Intergenic
1018637026 6:165871734-165871756 GGGCAGAATGTGCCAACCCCAGG + Intronic
1018746843 6:166768918-166768940 TCAAAGCATGGGAGAACCCCCGG - Intronic
1019931174 7:4224298-4224320 GGAAATCATGGGGAGACCCCAGG + Intronic
1020097475 7:5376949-5376971 GGAACGCAGGGGCCATGCCCTGG + Exonic
1021346100 7:19530410-19530432 GGAAAGCAAGAGCAAATCCCAGG - Intergenic
1026982360 7:74534270-74534292 GGAAAGCATGGGCCAACCCCTGG - Intronic
1027530411 7:79323864-79323886 GGAAAGCTTAGGTCTACCCCAGG - Intronic
1029735009 7:102460774-102460796 GATAGGCACGGGCCAACCCCTGG - Intronic
1030605244 7:111633171-111633193 TGATAGGATGGGCTAACCCCTGG + Intergenic
1031324567 7:120377759-120377781 GGAGAGCATGTGCCAACCTATGG - Intronic
1032308116 7:130755894-130755916 AGAAAACATTGGCTAACCCCTGG + Intergenic
1032671981 7:134092349-134092371 AGAAAGTATGGGCCATCCACAGG + Intergenic
1032858681 7:135858275-135858297 GCAAAGTAGGGGCCAAGCCCAGG - Intergenic
1033585983 7:142774601-142774623 GGAAAGCATCCTCCAACCTCAGG + Intergenic
1034329425 7:150269656-150269678 GGTAAGCAGGGGCCCTCCCCAGG + Intronic
1034668631 7:152840205-152840227 GGTAAGCAGGGGCCCTCCCCAGG - Intronic
1035292647 7:157849508-157849530 GACCAGCCTGGGCCAACCCCTGG + Intronic
1042875735 8:73438583-73438605 GGGAAGGCTGGGCCAAGCCCAGG + Intronic
1049010918 8:139886859-139886881 GAATCGCATTGGCCAACCCCAGG + Intronic
1050412615 9:5382469-5382491 GAACAGCATGGGCCAAAGCCTGG + Intronic
1051836228 9:21341241-21341263 GGAAAGCAATGGCGAGCCCCTGG - Intergenic
1053102275 9:35380977-35380999 GAAAAGAAGGGGCCAACCCAAGG - Intronic
1057302952 9:93896957-93896979 GGAATGCATGGCCCCACCCCAGG + Intergenic
1057518536 9:95741590-95741612 GGAGTGCTTGGGCCACCCCCTGG + Intergenic
1060325115 9:122606968-122606990 GGAAAGCATGTGTCATTCCCAGG + Intergenic
1060782892 9:126426196-126426218 AGAAAACATTTGCCAACCCCTGG + Intronic
1061665706 9:132160060-132160082 GGCAGACATGGGCCCACCCCTGG - Intergenic
1062327182 9:136017940-136017962 GGCAAGCAAGGTCCAGCCCCGGG - Intronic
1062634901 9:137485677-137485699 GGGAAGCCTGGGCCAGGCCCTGG + Intronic
1187424184 X:19162356-19162378 GGAAAGCATGGGTGACCTCCTGG + Intergenic
1192464358 X:71343308-71343330 AGAAAGTATGGCCCAACCACAGG - Intergenic
1198041347 X:132855873-132855895 GGAAAGCACTGACCAACTCCCGG - Intronic
1198132875 X:133716278-133716300 AGAAAGCATGGCCCATCCACAGG + Intronic
1199758762 X:150889333-150889355 GAAACCCATGGGCTAACCCCAGG - Intronic