ID: 1026982911

View in Genome Browser
Species Human (GRCh38)
Location 7:74537112-74537134
Sequence AAAAATACAAACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28501
Summary {0: 1, 1: 0, 2: 53, 3: 1468, 4: 26979}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026982906_1026982911 20 Left 1026982906 7:74537069-74537091 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG 0: 1
1: 0
2: 53
3: 1468
4: 26979
1026982908_1026982911 6 Left 1026982908 7:74537083-74537105 CCTGGGCAACAGAGTAAAGACCT 0: 1
1: 14
2: 193
3: 2601
4: 21655
Right 1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG 0: 1
1: 0
2: 53
3: 1468
4: 26979
1026982907_1026982911 10 Left 1026982907 7:74537079-74537101 CCAGCCTGGGCAACAGAGTAAAG 0: 5
1: 348
2: 7197
3: 67227
4: 198339
Right 1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG 0: 1
1: 0
2: 53
3: 1468
4: 26979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026982911 Original CRISPR AAAAATACAAACATGCAGCT GGG Intronic
Too many off-targets to display for this crispr