ID: 1026984309

View in Genome Browser
Species Human (GRCh38)
Location 7:74545472-74545494
Sequence CTGTGGACTAGGAGTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026984309_1026984314 4 Left 1026984309 7:74545472-74545494 CCATGGTCACTCCTAGTCCACAG 0: 2
1: 0
2: 2
3: 16
4: 149
Right 1026984314 7:74545499-74545521 TTCCAAATCTTCATTCAGGCTGG No data
1026984309_1026984312 0 Left 1026984309 7:74545472-74545494 CCATGGTCACTCCTAGTCCACAG 0: 2
1: 0
2: 2
3: 16
4: 149
Right 1026984312 7:74545495-74545517 AACCTTCCAAATCTTCATTCAGG No data
1026984309_1026984316 7 Left 1026984309 7:74545472-74545494 CCATGGTCACTCCTAGTCCACAG 0: 2
1: 0
2: 2
3: 16
4: 149
Right 1026984316 7:74545502-74545524 CAAATCTTCATTCAGGCTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026984309 Original CRISPR CTGTGGACTAGGAGTGACCA TGG (reversed) Intronic
900429025 1:2593313-2593335 CTGGGGACAAGGACTGCCCACGG + Intronic
900485960 1:2922980-2923002 CCGTGGGCTAGAGGTGACCAGGG - Intergenic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
901651357 1:10744944-10744966 CTGGGGACTTGGAGTGGCCGTGG - Intronic
901976837 1:12951842-12951864 CTGTCCATTAGGAGTGAGCAGGG + Intronic
902008333 1:13249928-13249950 CTGTCCATTAGGAGTGAGCAGGG - Intergenic
902027301 1:13393695-13393717 CTGTCCATTAGGAGTGAGCAGGG - Intergenic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
903679568 1:25088142-25088164 CTGTGACCTAGGGGTGACGATGG - Intergenic
903998364 1:27322414-27322436 CTGGGGACGAGGAGGGCCCAGGG + Intronic
904132106 1:28282707-28282729 CTGTGGAGTAATAATGACCATGG + Intergenic
905448058 1:38040242-38040264 CTGTGGTGTGGGTGTGACCATGG + Intergenic
905618176 1:39415728-39415750 CCTTGGACTAGGAGTGCTCAAGG - Exonic
906054896 1:42907880-42907902 CAGTGTAGTAAGAGTGACCATGG + Intergenic
906914577 1:49994979-49995001 CTGGGGACCAAGAGTGCCCACGG - Intronic
907811725 1:57877478-57877500 CTTTGGACTAGGACTGACTCAGG - Intronic
908170429 1:61499014-61499036 CTGAGAATCAGGAGTGACCAAGG + Intergenic
910842896 1:91577975-91577997 CTCTGGACAATGAGTGCCCATGG - Intergenic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG + Intronic
919655328 1:200192006-200192028 CTGTGAGCTAGGATTGACCGGGG + Intergenic
919690905 1:200527569-200527591 ATGTGGCCTAGGCCTGACCAAGG - Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
923944043 1:238862532-238862554 CTGGGGACTAGGGATGACAAAGG - Intergenic
924017083 1:239738907-239738929 CTGTGCCTTAGCAGTGACCAAGG - Intronic
1062939106 10:1408769-1408791 CTGTGGACTGAGAGAGACCACGG + Intronic
1071531228 10:86391615-86391637 CTGAGGAGGAGGAGTGAGCAAGG + Intergenic
1074222852 10:111455338-111455360 CTGAGGGCTGGGTGTGACCATGG - Intergenic
1081413321 11:42785238-42785260 CTGGGGGCAAAGAGTGACCAGGG + Intergenic
1081681536 11:45009067-45009089 CTGAGGACCAGATGTGACCAGGG - Intergenic
1082216962 11:49583071-49583093 ATCTGGAATAAGAGTGACCAAGG - Intergenic
1086632590 11:89041095-89041117 ATCTGGAATAAGAGTGACCAAGG + Intronic
1087277999 11:96179694-96179716 ATGTGGTCTAGGAGGGACCTGGG + Intronic
1090358682 11:126157965-126157987 CTGGGTCCTCGGAGTGACCAGGG - Intergenic
1090670566 11:128942372-128942394 CTGTGGACCAGGACTGACCCAGG + Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1094856683 12:34405988-34406010 CAGGGGACTAGGAGTGTCCTTGG + Intergenic
1095501203 12:42840156-42840178 CTGGGGACTAAGAGTGCCTACGG + Intergenic
1095509708 12:42937245-42937267 CTGTGAATTAGGAGTGCCCGTGG + Intergenic
1100730309 12:97459651-97459673 CTATGGAATAGAAGTTACCAGGG + Intergenic
1108818597 13:54318863-54318885 CTGAGGAATATGGGTGACCAAGG - Intergenic
1109398573 13:61793647-61793669 CTGAGGTCTAGGAGTGACAATGG - Intergenic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1115110955 14:29821327-29821349 CTGTGTACTCTGAGTTACCACGG - Intronic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1120394176 14:83946462-83946484 CTGTGAACAAGGAGTGCCAAGGG - Intergenic
1121043847 14:90773874-90773896 CTGTGGACTAGAGGTGACCTTGG - Intronic
1121187076 14:91982949-91982971 CAGTTGACTAGTAATGACCAAGG - Intronic
1121265912 14:92602475-92602497 CTGTGGCCAAGTTGTGACCATGG - Intronic
1122583629 14:102788184-102788206 CTGTGTACTAGGAGTGTGCCTGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1122803684 14:104245880-104245902 CTCTGGACCAGAAGTGAGCATGG - Intergenic
1124667513 15:31605870-31605892 CCGTGGACAGGGAGTGACAAAGG + Intronic
1126906753 15:53376142-53376164 CTGTGGGCTCTGGGTGACCAGGG - Intergenic
1128756000 15:70184443-70184465 CTGAGAACTAGGAGTGTCAAGGG + Intergenic
1131016004 15:89058340-89058362 CTAGGTACTAGGAGTGGCCAAGG - Intergenic
1131747319 15:95463027-95463049 CTGTGGACCTGGGGTGACAATGG - Intergenic
1131880858 15:96860523-96860545 CGGTGGTCTTGGAGTTACCAGGG - Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132308212 15:100833865-100833887 CTGTGGTCTTGAAGTCACCAGGG - Intergenic
1134867357 16:17620183-17620205 CACTGGACCAGGAGTGAGCAGGG - Intergenic
1137351402 16:47716965-47716987 CTGACCAATAGGAGTGACCACGG - Intergenic
1137610275 16:49813219-49813241 CTGTGGGGTTGGAGTCACCAAGG - Intronic
1137808225 16:51327784-51327806 CTGTGGAGTAGAATTGCCCAGGG - Intergenic
1142132077 16:88435735-88435757 CTGGGGACCAAGAGAGACCAAGG + Exonic
1142264782 16:89058649-89058671 CTGTGGGCCAGGAGGGACCCAGG - Intergenic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1144700219 17:17332785-17332807 CTATGGGCTCTGAGTGACCATGG - Intronic
1146674405 17:34763293-34763315 CTGTGGACACGGTGTGGCCATGG + Intergenic
1148858892 17:50593818-50593840 CTGTGGCCCCGGAGTGCCCATGG + Intronic
1150671715 17:67206260-67206282 CTGTTCACTAGGAGTTACAAAGG + Intronic
1151995276 17:77604438-77604460 CTGTGGACTCCGAGTGGCCAAGG + Intergenic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1162189782 19:8935867-8935889 CTGTGGAGGATGAGTGACCCAGG + Exonic
1163187668 19:15650340-15650362 CTGTGGACTAGCACCTACCAGGG + Intronic
1163534319 19:17868514-17868536 CTGTGAGCTAGGAGTGACAGTGG - Intergenic
1165635360 19:37335363-37335385 CTATGGACTAGGAATGACTAGGG - Intronic
1166773214 19:45297162-45297184 CTGTCGACTAGGAGGGTCCGAGG + Intronic
1167296672 19:48654553-48654575 CTGGGGACTGGGGGTGGCCAGGG - Intergenic
925143777 2:1567804-1567826 CTGGGGACTGGAAGTGACCCAGG - Intergenic
930708580 2:54528801-54528823 CTGTGGTCTAGAAGAAACCAGGG + Intronic
931213748 2:60222498-60222520 CTGTTGACTAGGAGTGCCCATGG - Intergenic
931777912 2:65555980-65556002 CTTTGGACAAGGAGAGACGAGGG - Intergenic
933838360 2:86264294-86264316 CTGCGGACCAAGAGTGACCCAGG + Intronic
938320503 2:130359333-130359355 AGGTGGACTGGGAGTGGCCAGGG + Intronic
938615256 2:132991089-132991111 CTGTGGAATCAGACTGACCAGGG + Intronic
940887576 2:159002803-159002825 CTGTGTAATAGAGGTGACCATGG + Intronic
941465209 2:165817372-165817394 CTGTGGACTGAGAGTGACAGGGG + Intergenic
942745690 2:179229385-179229407 CTGAGGACTAGGAGCAACAATGG - Intronic
946152870 2:217787975-217787997 CTGTGAAATGGGAGTGATCACGG + Intergenic
947204940 2:227651877-227651899 TTGAGGACCAGGAGAGACCATGG + Intergenic
947532522 2:230921726-230921748 AAGTGGAATGGGAGTGACCATGG + Intronic
948409240 2:237746571-237746593 CTGTGTACTTGGAGGCACCAAGG - Intronic
1169059315 20:2649794-2649816 CTGTGGGCCAGGTGTGACAATGG - Intergenic
1169567114 20:6867207-6867229 ATGTAGACTAGCAGTCACCAAGG + Intergenic
1170339477 20:15307277-15307299 CTGTGGACCAGCTATGACCACGG + Intronic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1182561798 22:31165663-31165685 ATGTGGAGTTGGAGTGGCCATGG + Intronic
1183299586 22:37052222-37052244 CTGTGGACAGGGAGAGACCTGGG + Intronic
1183578786 22:38709953-38709975 TTGCTAACTAGGAGTGACCAGGG - Intronic
1184119975 22:42443868-42443890 CTGTGAACTAGAAGAGAGCATGG + Intergenic
951809300 3:26682121-26682143 CTGGGGACTATGGTTGACCAGGG + Intronic
952892054 3:38049891-38049913 CTGTTGCCAAGGAGAGACCAGGG + Intronic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954366339 3:50148153-50148175 CTCAGGACTAGGAGAGACCTAGG - Intergenic
955267818 3:57464199-57464221 CTGTGGACAAGCAGAGACAAAGG + Intronic
956799883 3:72747568-72747590 CTGAGGACTTGGGGTGACCAAGG + Intergenic
957073082 3:75580741-75580763 CTGTGGACCAGGAGTGGTGATGG + Intergenic
958613946 3:96466429-96466451 CTGTGGATTAGCAGTGACCTGGG + Intergenic
960913079 3:122668752-122668774 CTCTGCACTAGCAGTGAGCAAGG + Intergenic
961697703 3:128717293-128717315 CTGGGGACCAGAAGTTACCAAGG + Intergenic
961807243 3:129498253-129498275 CAGGGGACCAGGGGTGACCACGG - Intronic
962476742 3:135761641-135761663 CTGTGTCCTCGGAGTCACCATGG + Intergenic
964664063 3:159152459-159152481 GTCTGAACTAGGAGAGACCATGG + Intronic
965043805 3:163548704-163548726 TTTTGGACTATGATTGACCATGG + Intergenic
967949942 3:194833031-194833053 CTGTGGACTGGCAGTGACCTTGG - Intergenic
968437715 4:602694-602716 CTGTGGGCTAGGTGGGCCCAAGG - Intergenic
973641219 4:52904790-52904812 CTTTGGAATAAGAGTGACCTTGG + Intronic
975547085 4:75570911-75570933 CTGTGGACTGGCAGTTACCAAGG + Intergenic
976862546 4:89683055-89683077 CTGTGGTCTAGGAATTACCAAGG - Intergenic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
978582689 4:110248069-110248091 CTATGGGCTAGCAGTGACCATGG + Intergenic
983739547 4:171111790-171111812 GTGTGGACTATGAAAGACCAAGG + Intergenic
985023222 4:185713212-185713234 GTGTGGGCTTGGAGTGTCCAAGG - Intronic
986651886 5:9972147-9972169 CTGAGAACCAGGAGAGACCACGG + Intergenic
987973070 5:24976157-24976179 CAATGGACTAGTAGTCACCAGGG - Intergenic
989163154 5:38410663-38410685 CTATGGCCCAGGAGTGCCCATGG - Intronic
990162334 5:52956132-52956154 CTGTGGCCTTGGAGAGAACATGG - Exonic
992901214 5:81298825-81298847 ATGAGGACTAGAAGTGTCCAAGG - Intergenic
995362670 5:111316196-111316218 CTGTGGAGCAGGAATGGCCAAGG - Intronic
998138414 5:139686701-139686723 ATGTGGGCTGGGACTGACCAGGG + Intergenic
1001667837 5:173448104-173448126 CTGTGGACAAGGGGTGGTCAAGG - Intergenic
1005230163 6:23690897-23690919 CTGTGGAATAGGTAAGACCACGG + Intergenic
1007241194 6:40426446-40426468 CTTTGGACCAGGACTTACCAAGG + Intronic
1011218573 6:85031160-85031182 CTGGAGAATAGCAGTGACCATGG - Intergenic
1017602679 6:156100677-156100699 CTTTGGAGTAGGAGTGGGCAAGG - Intergenic
1017941276 6:159055431-159055453 CTGGGGTCTAGGAGTGACCAAGG + Intergenic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1022030878 7:26491002-26491024 ATGAGGACTAGGAGTGCTCAGGG - Intergenic
1024467940 7:49732934-49732956 CTGTGGCCTTGGAGTGTACAAGG + Intergenic
1024756274 7:52536711-52536733 ATGTGCACTAGGAGTGAAGAAGG - Intergenic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG + Intronic
1026563420 7:71469354-71469376 CTGTGGCCTAGGACTGGTCACGG + Intronic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1029192813 7:98783763-98783785 TTGTGGATTTGGAGAGACCAAGG - Intergenic
1031694985 7:124839839-124839861 CTGTGGACTTTGAGTGATAATGG - Intronic
1032949397 7:136889940-136889962 CTGTTGACTAGGATTTTCCAGGG + Intronic
1034549829 7:151813399-151813421 CTGGTGATTAGGAGTGACCTGGG - Intronic
1035212705 7:157339999-157340021 CTGTGGACTGGGTGTCACCGCGG + Intronic
1036573333 8:10001338-10001360 CTGAGAACTAGGAGTGCCAAAGG - Intergenic
1037359007 8:18053732-18053754 CTGTGGACCAGAAGAGACCTGGG - Intergenic
1043089188 8:75876082-75876104 TCTTGGACTAGGAGTGAGCAAGG + Intergenic
1045317514 8:101056166-101056188 CTGAGTACTGGGAGTTACCAAGG + Intergenic
1049200025 8:141335492-141335514 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1049200101 8:141335886-141335908 ATGTGTATCAGGAGTGACCAGGG + Intergenic
1059524764 9:114980408-114980430 CTATGGCCTAGTAGTGACCCTGG + Intergenic
1062027318 9:134346566-134346588 CTGGGGACTAGGGGTGCCCAGGG + Intronic
1186680020 X:11862890-11862912 TTGTGGACTAGGACTAACTAAGG + Intergenic
1189388121 X:40554219-40554241 CTGTTGAGTAGGAGTGATGACGG - Intergenic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1192220429 X:69194123-69194145 CTGTGGACATGGAGTGCCCCTGG - Intergenic
1192792893 X:74400467-74400489 CTGTGGACTTTGAGTGATAATGG + Intergenic
1194758234 X:97763083-97763105 CTCATGACAAGGAGTGACCAAGG + Intergenic
1196462072 X:115942116-115942138 CTGTGGGCAAGCACTGACCAGGG + Intergenic
1199182195 X:144871200-144871222 CTGTGGTCTAAGAGTGTCCTTGG + Intergenic