ID: 1026986891

View in Genome Browser
Species Human (GRCh38)
Location 7:74560302-74560324
Sequence TAGGCGAGGTTGGAGGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026986882_1026986891 19 Left 1026986882 7:74560260-74560282 CCTGCTCCTCCTGATAAAGGGGC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1026986891 7:74560302-74560324 TAGGCGAGGTTGGAGGTGAGTGG No data
1026986885_1026986891 10 Left 1026986885 7:74560269-74560291 CCTGATAAAGGGGCTCTGGTTGA 0: 1
1: 0
2: 2
3: 12
4: 102
Right 1026986891 7:74560302-74560324 TAGGCGAGGTTGGAGGTGAGTGG No data
1026986884_1026986891 13 Left 1026986884 7:74560266-74560288 CCTCCTGATAAAGGGGCTCTGGT 0: 1
1: 0
2: 1
3: 5
4: 98
Right 1026986891 7:74560302-74560324 TAGGCGAGGTTGGAGGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026986891 Original CRISPR TAGGCGAGGTTGGAGGTGAG TGG Intronic
No off target data available for this crispr