ID: 1026987218

View in Genome Browser
Species Human (GRCh38)
Location 7:74562151-74562173
Sequence CTCACACGGTTCCCGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026987214_1026987218 4 Left 1026987214 7:74562124-74562146 CCAGAATGGGCTTTTCTCAAACT 0: 1
1: 1
2: 2
3: 20
4: 212
Right 1026987218 7:74562151-74562173 CTCACACGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026987218 Original CRISPR CTCACACGGTTCCCGAAGCC TGG Intronic
903388783 1:22948708-22948730 CTCTCACAGTTCCAGAAGCCAGG + Intergenic
906848949 1:49226873-49226895 CTCTCACAGTTCTGGAAGCCAGG + Intronic
907038534 1:51237057-51237079 CCCACACGGTGCCCGAGGGCAGG - Intronic
912380105 1:109242816-109242838 CTCACACTGTTCCCCCTGCCTGG + Intergenic
916058085 1:161081696-161081718 CTCACACCGTACCCGCTGCCTGG + Intronic
920301651 1:204992585-204992607 CTCACCCTGTTCCCCAGGCCTGG - Intronic
922212218 1:223495101-223495123 CTCAGATGGTGCCCCAAGCCAGG + Intergenic
922695413 1:227728683-227728705 CTCACAGGGTCCCAGAAGCAAGG + Intronic
1064947226 10:20804637-20804659 CACACACTGTTCCCCCAGCCTGG - Intronic
1069618782 10:69823574-69823596 CTCACCCAGGTCCCCAAGCCAGG + Intronic
1070291282 10:75116839-75116861 CTCACTTCGTTGCCGAAGCCTGG + Intronic
1070653379 10:78254046-78254068 CACACACTGTTCCCCAACCCTGG - Intergenic
1070814364 10:79313531-79313553 CTCTCTCTGTTCCCCAAGCCTGG - Exonic
1071872032 10:89806460-89806482 CTCACAAGGTTCCAGGTGCCAGG - Intergenic
1075621899 10:123934261-123934283 CTCTCACAGTTCTGGAAGCCAGG + Intronic
1077159960 11:1108155-1108177 CTCTCCCTGTGCCCGAAGCCCGG + Intergenic
1080420536 11:32106186-32106208 CTTACACGGTTCTGGAGGCCAGG + Intergenic
1080667462 11:34348488-34348510 CTCACACTGTTCCCTCTGCCTGG + Intronic
1082004891 11:47414027-47414049 CTCACACTGTTCCCCCTGCCTGG + Intronic
1085777152 11:79377252-79377274 CTCTCACAGTTCTGGAAGCCAGG - Intronic
1088539918 11:110902833-110902855 ATCACATGGTCCCCAAAGCCAGG + Intergenic
1096556269 12:52406030-52406052 CCCAGTCGGTACCCGAAGCCAGG + Exonic
1096975406 12:55696949-55696971 GCCACACGGTGCCCGAGGCCTGG + Exonic
1097198432 12:57258004-57258026 CTCACACAGTTCCCCCGGCCTGG - Exonic
1099430123 12:82573382-82573404 CTCTCATGGTTCTGGAAGCCAGG + Intergenic
1102056886 12:109903109-109903131 CTCCCACTGCTGCCGAAGCCGGG - Exonic
1103893954 12:124261070-124261092 CTCTCACGGTTCTGGAGGCCAGG + Intronic
1104293862 12:127494161-127494183 TTCACATTGTACCCGAAGCCTGG - Intergenic
1112771061 13:102795352-102795374 CTCAGACTGGTCCCGAACCCTGG - Intronic
1120931920 14:89857421-89857443 AAAACACGGTTCCCGATGCCTGG + Intronic
1129378599 15:75151367-75151389 CTCGCATGATTCCCAAAGCCTGG + Intergenic
1129629753 15:77245671-77245693 CTCACTCGGTTTCCCAGGCCAGG - Intronic
1138127692 16:54452391-54452413 CCCACATGGTGCCCAAAGCCTGG - Intergenic
1139548910 16:67662724-67662746 CTCACAGGGCTCCCTCAGCCTGG + Exonic
1142666463 17:1466653-1466675 CTCACTCTGTTCCCCAGGCCTGG + Intronic
1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG + Intronic
1143137369 17:4719403-4719425 CTCACATGGTGCTGGAAGCCAGG - Exonic
1151249024 17:72819388-72819410 CTCACACAGTTCTGGAGGCCAGG - Intronic
1152216249 17:79034299-79034321 CTCACACGGTTCTCAAAGCAGGG + Exonic
1153924840 18:9826775-9826797 CTCACAGAGGTCCCAAAGCCAGG - Intronic
1155214481 18:23630935-23630957 CTCACTTTGTTCCCTAAGCCTGG - Intronic
1160130751 18:76222938-76222960 CTGACACGCTTCCCCATGCCTGG + Intergenic
1160192787 18:76728293-76728315 CTCCCACCGTTCCCAAACCCTGG + Intergenic
1160748194 19:721084-721106 CACACACGGTTCCCCCTGCCCGG - Intronic
1165146277 19:33732844-33732866 CTCACAAGGTTCCCTAAGGTAGG + Intronic
932746916 2:74341513-74341535 CCCACACTGTTCCCACAGCCTGG + Intronic
936496674 2:113028281-113028303 CTCACTGGGTTCCCATAGCCTGG + Intronic
939133571 2:138267271-138267293 CTCACAAGGTCCCAGAAGCCTGG - Intergenic
941030442 2:160505335-160505357 TTCCCACGGTGCCCGAATCCAGG + Intergenic
942927072 2:181446626-181446648 CTCACTCTGTTTCCCAAGCCTGG - Intergenic
944200147 2:197098142-197098164 CTCACTCTGTTCCCACAGCCTGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946429295 2:219616111-219616133 CTCCCATGGTTCCCGGATCCAGG - Exonic
1172332129 20:34082511-34082533 TTCTCACGGTTCTCCAAGCCTGG - Intronic
1172906115 20:38370780-38370802 ATCACTGGGTTCCTGAAGCCAGG + Exonic
1173031494 20:39365233-39365255 CTCACTCTGTTCCCCAGGCCTGG - Intergenic
1173537018 20:43823234-43823256 CTCCCAATGTTCCCAAAGCCTGG - Intergenic
1175202907 20:57290326-57290348 CTCTCACAGTTCCAGAAGCCTGG + Intergenic
1182470485 22:30545085-30545107 CTCACACGGTTCCATGAGCATGG - Intronic
1183712634 22:39514403-39514425 CTCACAGGGTTCCTGCTGCCTGG + Exonic
955671156 3:61404623-61404645 CTCATGTGGTTCCAGAAGCCAGG - Intergenic
959989738 3:112617779-112617801 TTCACATGGTTTCAGAAGCCTGG + Intronic
961792506 3:129386265-129386287 CTCACTCTGTTCCCCAGGCCAGG + Intergenic
969615808 4:8252066-8252088 CTCTCACGGTTCTGGAGGCCAGG + Intergenic
969975346 4:11094599-11094621 CTCGCACTGTTGCCCAAGCCGGG - Intergenic
972072793 4:35042093-35042115 CTCACTCTGTTGCCCAAGCCAGG - Intergenic
974320730 4:60345856-60345878 CTCACTTGGCTCCCTAAGCCTGG + Intergenic
983903708 4:173163573-173163595 TTCACACAGTTCCTGAAGTCAGG - Intergenic
1002249717 5:177919922-177919944 CACACACAGTTCCTGAATCCAGG - Intergenic
1003856197 6:10278879-10278901 CTCTCACAGTTCTGGAAGCCAGG + Intergenic
1017830208 6:158120501-158120523 CTCACACGCTGCCAGAATCCTGG - Exonic
1025995568 7:66525285-66525307 CTCACACAGTGCCCAAAGCCTGG + Intergenic
1026987218 7:74562151-74562173 CTCACACGGTTCCCGAAGCCTGG + Intronic
1034347934 7:150398359-150398381 CTCACTCGGTGCTTGAAGCCTGG - Exonic
1037702377 8:21286819-21286841 CACACAGGGTTCCAGAAGCATGG + Intergenic
1044523314 8:93224343-93224365 CTCACAGGGTCACAGAAGCCAGG - Intergenic
1045981915 8:108199657-108199679 CTCACATGGTTGCCTAAGGCAGG - Intergenic
1047903636 8:129449870-129449892 CTCACACAGTCCCTGAAGCCTGG - Intergenic
1049573152 8:143378861-143378883 TTCCCACGGTTCCCGCAGCTGGG - Intronic
1062207584 9:135345888-135345910 CACACATGGTTCCCAAACCCGGG + Exonic
1186888435 X:13938017-13938039 AACACCCGGTTCCCCAAGCCTGG - Intronic