ID: 1026987723

View in Genome Browser
Species Human (GRCh38)
Location 7:74565152-74565174
Sequence GGCTGAACGCCATTGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026987719_1026987723 -6 Left 1026987719 7:74565135-74565157 CCACGCTCGACCCTGGGGGCTGA 0: 1
1: 1
2: 0
3: 8
4: 108
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987718_1026987723 -5 Left 1026987718 7:74565134-74565156 CCCACGCTCGACCCTGGGGGCTG 0: 1
1: 1
2: 1
3: 5
4: 100
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987709_1026987723 24 Left 1026987709 7:74565105-74565127 CCAGCCCTGCCCGCAAGGGGCTG 0: 1
1: 1
2: 7
3: 38
4: 374
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987713_1026987723 14 Left 1026987713 7:74565115-74565137 CCGCAAGGGGCTGAGACAACCCA 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987710_1026987723 20 Left 1026987710 7:74565109-74565131 CCCTGCCCGCAAGGGGCTGAGAC 0: 1
1: 1
2: 1
3: 11
4: 212
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987712_1026987723 15 Left 1026987712 7:74565114-74565136 CCCGCAAGGGGCTGAGACAACCC 0: 2
1: 0
2: 0
3: 11
4: 177
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42
1026987711_1026987723 19 Left 1026987711 7:74565110-74565132 CCTGCCCGCAAGGGGCTGAGACA 0: 1
1: 1
2: 0
3: 25
4: 190
Right 1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026987723 Original CRISPR GGCTGAACGCCATTGGTAGC TGG Intronic
902226450 1:14999458-14999480 GGCTGAACGCACTGGGTAGGAGG - Intronic
910675232 1:89809550-89809572 GACTGAACACCATGGTTAGCTGG + Intronic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
919620663 1:199861207-199861229 GGCTGACAGCCTTTGGCAGCAGG - Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1078439453 11:11351948-11351970 TGCTGAGCGCCAGTGGCAGCTGG + Exonic
1089847804 11:121471981-121472003 GTCTGAATGCCTTTGGTGGCCGG + Intronic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1106468397 13:30033339-30033361 GGCTGAACCCAACTGGTAGGGGG - Intergenic
1108570325 13:51743326-51743348 GGCTGCAGGCCATTGGCAGAAGG - Intronic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1121611318 14:95282798-95282820 GGCTGTAAGCCAGTGGGAGCAGG - Intronic
1121805498 14:96816632-96816654 GGCTGAAGGGCATTGATAACAGG + Intronic
1136872664 16:33822523-33822545 AGTTGAAAGCCATTAGTAGCTGG + Intergenic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1203099508 16_KI270728v1_random:1293549-1293571 AGTTGAAAGCCATTAGTAGCTGG - Intergenic
1147694559 17:42341562-42341584 GCCTGACAGCCCTTGGTAGCAGG + Intronic
1149251549 17:54776052-54776074 GGCTGAACGTGCTTGGTATCAGG - Intergenic
1160039021 18:75328360-75328382 GGCTGCATGGCATTGGTAGAAGG + Intergenic
1161515728 19:4695280-4695302 GGCTGAGCGCCAATGGCAGGTGG - Intronic
1161758413 19:6151895-6151917 GGATGAACGCCCTAGTTAGCAGG + Intronic
1168282615 19:55313481-55313503 GCCTGTAGGCCATGGGTAGCGGG - Intronic
926126123 2:10272896-10272918 GTCTGAACGCCTTTGGTGCCTGG + Intergenic
940129930 2:150369759-150369781 GGCTGCTCGGCACTGGTAGCGGG - Intergenic
946878863 2:224157910-224157932 GGCAGAAGGCCACTGGTAGGAGG + Intergenic
1171795706 20:29565502-29565524 GTCACAAAGCCATTGGTAGCTGG - Intergenic
1179546358 21:42114919-42114941 GTCTGAAAGCCATCAGTAGCAGG - Intronic
1180891631 22:19292704-19292726 GGCTGCACGACAGTAGTAGCAGG + Intergenic
956777882 3:72580693-72580715 GGCTGATCTCCATGGGCAGCTGG - Intergenic
965906168 3:173709232-173709254 GGCTGAACTCCAGTGTTAGAAGG - Intronic
969530839 4:7729380-7729402 GGCTGAGGGCCCTGGGTAGCTGG + Intronic
976823485 4:89233618-89233640 GGCTGAATGCAATGGATAGCAGG + Intergenic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
992228348 5:74640468-74640490 AGGCGAACGCCATCGGTAGCCGG - Exonic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1002044180 5:176532849-176532871 GGCTGAACACCATTGGTCCCTGG - Intronic
1003333274 6:5147065-5147087 TGCTGGAAGCCATTGGTACCAGG + Intronic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1036700294 8:11008806-11008828 CACTGAATGCCATTGGTTGCAGG + Intronic
1042740959 8:72045925-72045947 GAATGAACCCCATTGGAAGCAGG - Intronic
1045892631 8:107175176-107175198 GGCTGTACTCCAGGGGTAGCAGG + Intergenic
1051655651 9:19379424-19379446 CGGTAAACGCCATTGGTAACTGG - Intronic
1055786492 9:79874527-79874549 GGCTGAACTCCAGAGGTGGCAGG + Intergenic
1056453269 9:86737020-86737042 GGCTGAAAGGCCTTGGTTGCTGG + Intergenic
1189909871 X:45799713-45799735 GGCTGAGTGCCTTTGGAAGCTGG - Intergenic
1196287209 X:113897074-113897096 GGCTGAATGCTATTGTTACCAGG + Intergenic