ID: 1026988505

View in Genome Browser
Species Human (GRCh38)
Location 7:74569769-74569791
Sequence CAGGGTGTGAAGAGGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026988497_1026988505 13 Left 1026988497 7:74569733-74569755 CCCACGATGGATGGGGTTAGGAT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG 0: 1
1: 0
2: 0
3: 38
4: 492
1026988498_1026988505 12 Left 1026988498 7:74569734-74569756 CCACGATGGATGGGGTTAGGATC 0: 1
1: 0
2: 0
3: 7
4: 53
Right 1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG 0: 1
1: 0
2: 0
3: 38
4: 492
1026988496_1026988505 14 Left 1026988496 7:74569732-74569754 CCCCACGATGGATGGGGTTAGGA 0: 1
1: 0
2: 0
3: 8
4: 63
Right 1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG 0: 1
1: 0
2: 0
3: 38
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026988505 Original CRISPR CAGGGTGTGAAGAGGGCGGA AGG Intronic
900110006 1:1001391-1001413 CAGGGTGCGAAGGGGGCGCAGGG + Intergenic
900120439 1:1046536-1046558 GAGGTCGTGATGAGGGCGGAGGG - Exonic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900270816 1:1787499-1787521 CATGTTGTGACGAGGACGGATGG + Intronic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
900622166 1:3592444-3592466 CAGGGTGTGACGAGGCCTGCAGG - Intronic
900663375 1:3797416-3797438 CAGGGTGGGGTGCGGGCGGATGG + Intergenic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
901186489 1:7376689-7376711 CAGGTTGTGAACATGGAGGATGG + Intronic
901210961 1:7525854-7525876 CACGGTCTGAAGAGGGAGGCAGG + Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901479988 1:9518613-9518635 CAGGGTGTGGTGGGGGCGGGGGG - Intergenic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
904293653 1:29503898-29503920 CAGGGTGTGAGGAGGCTGCAGGG + Intergenic
904788267 1:32998716-32998738 CAGGGGGTGATGGGGGTGGAGGG - Intergenic
904927835 1:34062535-34062557 AAGGTGGTGAAGAGGGCAGAGGG + Intronic
905276947 1:36824532-36824554 AAGGGAGTGAAGTGGGGGGAGGG + Intronic
905709153 1:40086209-40086231 CAGGGAGTGTAGAGGTAGGAGGG + Intronic
906295068 1:44644665-44644687 CAGGGTGTGAGGAGGGCCTGGGG - Intronic
907274831 1:53311260-53311282 CAGGGTGTGAGGAGCGGGGAGGG + Intronic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907491780 1:54813212-54813234 CATGGTGTGGAGAGGGCAGTGGG - Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
910240010 1:85076118-85076140 CTGGCTGTGAAGAGGAAGGAAGG - Intronic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
913001918 1:114589220-114589242 GACAGTGTGAAGAGGGCGGGGGG - Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913542116 1:119831399-119831421 GAGGGTGGGAAGTGGGAGGAGGG + Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
915103367 1:153516271-153516293 CAGGGTGGGAGGAGGTAGGATGG - Intergenic
915215675 1:154339230-154339252 CAGGGTGTGAAGAGGAGAGTTGG + Intronic
915469141 1:156115305-156115327 CGGGGAGTGGAGAGGGCGGCGGG + Intronic
915527024 1:156482241-156482263 CAGGGTCTGAGGAGGAAGGAAGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917372196 1:174305906-174305928 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
920269845 1:204754729-204754751 AAGGGTGTGAAGAGAGGGAATGG - Intergenic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
922390687 1:225138264-225138286 CAGGCTGTGAAGAGTGCAGATGG - Intronic
922479386 1:225928449-225928471 AGGGGAGTGAAGAGGGAGGAAGG - Intergenic
922718235 1:227887702-227887724 CAGGTGGTGATGAGGGCGGGCGG + Intergenic
923465226 1:234242284-234242306 CAGGCTGGGAAGCGGGTGGAAGG - Intronic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
924539890 1:244970737-244970759 AAGAGGGTGAAGAGGGCGGGAGG - Exonic
1063033884 10:2266377-2266399 AAGGGTGTGAAGAGGCTGTAGGG + Intergenic
1063749756 10:8930066-8930088 AAGGGTGTGGAGTGGGTGGAGGG + Intergenic
1064288425 10:14012483-14012505 CAGGGTGTGAAAGGGGTGGCGGG + Intronic
1064335298 10:14435184-14435206 CAGGGTGGGATGAGGGCAAAAGG + Intronic
1065443261 10:25773168-25773190 CCGGGTGTGAGGAGGGGGGGTGG + Intergenic
1065610462 10:27466834-27466856 CCGGGTGTGAGGAGGGGGGGTGG - Intergenic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1069890956 10:71652237-71652259 CAGGCTGGGAAGAGGGGGCAGGG - Intronic
1070490321 10:76969899-76969921 CAGGGTGAGGAGAGGGCGAGGGG + Intronic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071436021 10:85648802-85648824 CAAGGTGTGGAGAGGGCACAGGG - Intronic
1072189147 10:93066369-93066391 CCAGGTGGGAGGAGGGCGGAGGG + Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1074267628 10:111920638-111920660 GAGGGTGTGAAGAGGAGGAAGGG - Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075075713 10:119349026-119349048 GTGGGTGGGAGGAGGGCGGAGGG - Intronic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1076160971 10:128243962-128243984 CGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076561957 10:131372881-131372903 GAGGGTGTGGAGAGTGCTGATGG - Intergenic
1076854021 10:133106460-133106482 CAGGGGCTGAAGAGAGCAGAGGG - Intronic
1077355867 11:2116704-2116726 CAGGGGGTGAAGTTGGAGGAAGG + Intergenic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077862120 11:6191213-6191235 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1079414068 11:20216504-20216526 TTGGCTGTGAAGAGGGAGGAAGG - Intergenic
1079839670 11:25381302-25381324 TAGGGTGGGAGGAGGGGGGAGGG - Intergenic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1083623141 11:64058816-64058838 GAGGGCGTGAAGAGGGCAGCCGG + Intronic
1084027943 11:66464515-66464537 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1084161610 11:67353344-67353366 CCGGTTGTGAAGAGGAGGGAGGG - Exonic
1084210042 11:67616661-67616683 CAAAGTGTGAAGGGGGCAGAGGG - Intergenic
1084353982 11:68624604-68624626 CAGGGTGTGAGGAGGGGAGGTGG - Intergenic
1084463520 11:69309135-69309157 CAGGGCCTGAAGCAGGCGGAGGG + Intronic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1084754211 11:71224532-71224554 TTGGGTGGGAAGAGGGTGGATGG - Intronic
1085442851 11:76579281-76579303 CTGGGAGGGAAGAGGCCGGAAGG + Intergenic
1085797114 11:79552412-79552434 CAAGGTGTGAAAGGGGAGGAGGG - Intergenic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087093992 11:94303106-94303128 TAGGGTGTGAAGAAGGACGAAGG - Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088927355 11:114315865-114315887 CAGGGTGCTAAGGGGGAGGATGG + Intergenic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089980964 11:122772219-122772241 CAGGGTGTCAAGAGAGCTCACGG - Intronic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090419660 11:126565742-126565764 CAGGGAGTGAAGTGGGGGAAGGG + Intronic
1090905347 11:131069616-131069638 GAGGGGGTGAAGAGGGGTGAGGG - Intergenic
1090939080 11:131371997-131372019 CAGGGGGAGAAGAGGGCGAGGGG - Intronic
1091345812 11:134853223-134853245 CAGGGTGTTAAGAGGGTGCTGGG + Intergenic
1091548269 12:1518855-1518877 CGGGGTGTGAACAGGGGTGACGG + Intergenic
1091707428 12:2705479-2705501 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1091799098 12:3313572-3313594 CAGGGTGTCAGGAGGGGTGAGGG + Intergenic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1098194278 12:67983456-67983478 CAGGGTGTGCAGAGGTCACATGG - Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101492492 12:105222444-105222466 CAGGGTGTGGTGAGTGAGGAAGG + Intronic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102229142 12:111250333-111250355 CAGGGTGTGAATTGGGGGGCGGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1103702501 12:122855192-122855214 CAGGCTATGGAGATGGCGGAAGG + Intronic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104605512 12:130184778-130184800 CAGGGTGGGGAGGGAGCGGAAGG - Intergenic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105279137 13:18953060-18953082 CAAGGTTGGAGGAGGGCGGAGGG + Intergenic
1107147032 13:37070299-37070321 CAGGCTGTTAAGAGGGTAGAAGG + Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1108792112 13:53982875-53982897 AAGGGTATGAAGAGGGCAAAGGG + Intergenic
1108800115 13:54084531-54084553 CAGGGAGTGTAGAGGGAGAAGGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1111119606 13:83829603-83829625 CAGACTGTTAAGAGGGCAGAAGG + Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112803663 13:103138717-103138739 CAGGGAGTGAAGAAAACGGAGGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1115422533 14:33213137-33213159 CAGTGAGTGAAGAGGCCTGATGG - Intronic
1115664845 14:35534817-35534839 CAGAGTCTGAAGCGGGCGGCCGG + Exonic
1116198693 14:41762115-41762137 CAGGGTGTGAAGACAGAGGGTGG - Intronic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117309931 14:54510935-54510957 CATGGTCTGAAGAGGTCAGAGGG + Intronic
1117528193 14:56632499-56632521 CAAGGTTTGAAGAGAGTGGAGGG - Intronic
1117616203 14:57536191-57536213 CAGAGAGTGAAGAGAGGGGAAGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1120881370 14:89417258-89417280 CGGGGAGGGAGGAGGGCGGAGGG + Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121787150 14:96670657-96670679 CTGGGTGTGAGGGGGGCGGTGGG - Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122298247 14:100717503-100717525 CAGGGTGTAAGGAAGCCGGAGGG - Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123991059 15:25683674-25683696 AAGGGAGTGAGGAGGGCGAAGGG - Intronic
1124068773 15:26371586-26371608 AAGGGTTTGGGGAGGGCGGAGGG - Intergenic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1124619366 15:31265170-31265192 CAGGGAGTGGAGGGGGCAGAGGG + Intergenic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126050428 15:44680143-44680165 CAAGGTGTGAACAGGGTGAAGGG - Intronic
1126194991 15:45921882-45921904 TAGGGTGGGAACAGGGCAGATGG - Intergenic
1126666926 15:51083778-51083800 CAGGGGGTGAACAGGGCAGAAGG + Intronic
1128254210 15:66185213-66185235 CAGGGTGGGAGGAGGGTGCAGGG - Intronic
1129137493 15:73567755-73567777 CAGGGTGTGAAGATGGAGAGTGG + Intronic
1131669789 15:94607618-94607640 CAGGATGAGAGGAGGGCGGCGGG - Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132663685 16:1072469-1072491 GAGAGTCTGAAGAGGGTGGAGGG - Intergenic
1132699091 16:1214669-1214691 CAGGGTGTGAAATGGGCTGGGGG + Intronic
1132848756 16:2014090-2014112 CAGGGTGTGAAGGGTGGGCAGGG + Intronic
1132856011 16:2044866-2044888 CAGGGTGTGTCGAGGGCGGGGGG - Intronic
1133556785 16:6913466-6913488 GGGGGTGTGAAGAAGGCCGATGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1135552451 16:23408416-23408438 CAGGGGGTGAGCAGGGCAGAAGG + Intronic
1135607438 16:23836430-23836452 CAGGGTGCGGAGGGCGCGGAGGG - Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1137430202 16:48412401-48412423 CAAGGTGGGAAGAGGGCTGAAGG - Intronic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1138182909 16:54954902-54954924 CAGGTTGGGAAGGGGGCAGAGGG - Intergenic
1139385563 16:66566792-66566814 CAGTGTGTGCAGAGGGCGTGGGG - Exonic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139510730 16:67427112-67427134 CATGGTGTGGGGAGGGCCGAGGG + Intergenic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142587003 17:979927-979949 CGGGGCGTGGCGAGGGCGGAGGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142968272 17:3594520-3594542 CAGGCTGTGAACAGGACGGACGG + Intronic
1143128903 17:4663653-4663675 CAAGGGGTGAAGTGGGGGGAGGG + Intergenic
1143520494 17:7441602-7441624 CAGGGTGGGAAGGGGGAGAATGG + Intronic
1143608448 17:8003782-8003804 CAGGGTGCGAGGAGGTCGGCTGG + Intronic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144192771 17:12861530-12861552 CTGGCTTTGAAGACGGCGGAAGG - Intronic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144816793 17:18040254-18040276 CAGGGTCTGAAAAGGGCTGGTGG - Intronic
1145270101 17:21400292-21400314 CAGGGTGTGAGGAGACAGGAGGG - Intronic
1145301709 17:21645571-21645593 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145308323 17:21687743-21687765 CAGGGTGTGAGGAGACAGGAGGG - Intergenic
1145328017 17:21848132-21848154 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145348601 17:22057753-22057775 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1145694822 17:26779516-26779538 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146852151 17:36231441-36231463 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1146868060 17:36355312-36355334 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1147070934 17:37955930-37955952 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147082460 17:38035456-38035478 CGGGGTGTGGGGAGGGGGGAGGG + Intronic
1147098404 17:38159423-38159445 CGGGGTGTGGGGAGGGGGGAGGG + Intergenic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147650732 17:42060432-42060454 CAGGGTGTGGAGAGGACAGCGGG - Intronic
1148350277 17:46936508-46936530 CAGGGTGTGAGGCAGGTGGAGGG - Intronic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150483517 17:65528517-65528539 CAGGGTGGGAACAGGGCCGAGGG - Intergenic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1152567958 17:81108546-81108568 GTGGGTGTGAAGAGGCCGGGTGG + Intronic
1203192637 17_KI270729v1_random:204353-204375 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1203202004 17_KI270730v1_random:3788-3810 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1154099434 18:11456196-11456218 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1154236388 18:12610058-12610080 CAGGCTGGGAAGAGGAGGGAGGG - Intronic
1154380900 18:13848964-13848986 GAGGGCGTGGAGAGGGCCGAAGG - Intergenic
1155352187 18:24917640-24917662 CAGGGGAGGAAGAGGGCGGGGGG + Intergenic
1155478406 18:26259424-26259446 CGGGGTGGGAGGAGGGGGGAGGG - Intronic
1155625155 18:27826024-27826046 AAGGGTCTGAGGAGGGGGGAGGG + Intergenic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1159556225 18:69947891-69947913 CAGAGGCTGAAGTGGGCGGAGGG + Intronic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1160820889 19:1057238-1057260 CAGGGTGGGAACAGGGCTGAGGG + Intronic
1160853886 19:1207292-1207314 CAGGGTGTTAAGAGGAAGTAAGG - Intronic
1160872082 19:1282224-1282246 GAGGGTGTGAAGGGGAAGGAGGG + Intergenic
1161108217 19:2455117-2455139 CAGGGTGGGTAGGGGGCCGAGGG - Intronic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1162029131 19:7909862-7909884 CGGGGTGTGAACAGGGTTGACGG - Exonic
1162095849 19:8309551-8309573 CAGGGTGTGCAGAGGCCACAAGG - Intronic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162931979 19:13962060-13962082 CCGGCTGTGAGGAGGGCGGCAGG - Exonic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164845512 19:31429323-31429345 AAGGGAGTGAAGAGGGTGGCAGG + Intergenic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1166599594 19:44082249-44082271 CAGGGTGGGAAGAGGGGGTGGGG - Intronic
1167070960 19:47221734-47221756 CAGGGTGTCAGGAGGTGGGAGGG + Exonic
1167272242 19:48511926-48511948 AAGGGTGGGAGGAGGGAGGATGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167649109 19:50719846-50719868 GAGGGAGGGGAGAGGGCGGAGGG - Intergenic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1168184755 19:54692577-54692599 AAGGGTGGGAAGAGGGGAGAGGG + Intronic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925296318 2:2779886-2779908 CAGGGTGTGAAGGTAGGGGAGGG - Intergenic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925454255 2:4001072-4001094 CAGGGTCTGAAGGGGGCAAAAGG - Intergenic
926914688 2:17879866-17879888 CAAGGCGTGAAGTGGGGGGAGGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
929054993 2:37868980-37869002 CTGGCTGTGAAGATGGCAGAGGG - Intergenic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
933529974 2:83496480-83496502 TAGGGTGTGGAGAGGTGGGAGGG - Intergenic
933979634 2:87539417-87539439 TAGGGACTGAAGAGGGTGGAGGG + Intergenic
935179901 2:100679891-100679913 CAGGGTTTGAAGAGGGAGTCAGG + Intergenic
935387228 2:102512963-102512985 CAGGGTGTGGAGGGCGCAGAGGG + Intronic
936314186 2:111411374-111411396 TAGGGACTGAAGAGGGTGGAGGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937305395 2:120867575-120867597 CAGCGTGCGGGGAGGGCGGAGGG - Intronic
937906133 2:127053756-127053778 CAGGAGGTGATGAGGGCTGAAGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
938672061 2:133596179-133596201 CATGGAGTGATGAGGGAGGAAGG - Intergenic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
940731455 2:157397738-157397760 TGGGGTGGGAGGAGGGCGGAGGG - Intergenic
941362308 2:164566250-164566272 CATGGTGTGACCAGGGCAGATGG + Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
943999313 2:194811884-194811906 CGGGGTGTGGGGAGGGGGGACGG + Intergenic
944164055 2:196698831-196698853 CCGGGTGGGGAGAGGGGGGAGGG - Intronic
944501410 2:200364082-200364104 CAGGCTTTGAAGATGGGGGAAGG + Intronic
945194711 2:207227371-207227393 CAGGGTATGAGGTGGGGGGAGGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
947391842 2:229647197-229647219 CAGGGTAAGAAGAGGTCAGAGGG + Intronic
948379363 2:237542041-237542063 GAGAGTGTGAGGAGGGTGGACGG + Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1169859641 20:10137809-10137831 CAGGATGTGAAGCAGGCAGAGGG - Intergenic
1170003913 20:11645726-11645748 CATGGTGTGGTGAGGGCCGAAGG + Intergenic
1171089614 20:22271568-22271590 CAGAGTGGGAAGAGGGCTCATGG + Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171518287 20:25756954-25756976 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1171558570 20:26099252-26099274 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1172958764 20:38782179-38782201 CAGGGTGTAAAGATGGTGCAGGG + Intergenic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1173575872 20:44112768-44112790 CAGGGTGGGAAGAGGGGTTAAGG - Exonic
1173575958 20:44113100-44113122 CAGGGTGGGAGGAAGGGGGATGG + Exonic
1174145226 20:48448544-48448566 CATGGTGGGAAGAGGGCAGCAGG + Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176206299 20:63890194-63890216 CAGGAAGTGGACAGGGCGGAGGG + Exonic
1176652447 21:9563368-9563390 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1178341732 21:31791352-31791374 CAGGGAGTCAAGAGGTCTGAGGG - Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180187384 21:46146231-46146253 AGGGGTGAGAAGAGGGCGGGAGG + Intronic
1180196197 21:46195784-46195806 CCGGCTGTGAACAGGGTGGAAGG - Intronic
1180228578 21:46412989-46413011 CAAGGTGTGGGGAGGGGGGAAGG + Exonic
1180228690 21:46413348-46413370 CAAGGTGTGGGGAGGGGGGAAGG + Intronic
1180551051 22:16541722-16541744 TGGGGTGAGAGGAGGGCGGAGGG - Intergenic
1181495991 22:23287847-23287869 CAGGGTGTGATGCTGGCAGAGGG - Intronic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183727044 22:39595926-39595948 CAGGGCGTGAAGAGGGCGTGCGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184095196 22:42312613-42312635 CAGGGTGTGGAGTGGGCTGTGGG + Intronic
1184289085 22:43488828-43488850 CAGCGCCTGAGGAGGGCGGACGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184810020 22:46824907-46824929 CAGGGTGTCAAGTGGGCAGCTGG + Intronic
952704402 3:36362780-36362802 GAGGGTGTCAAGAGGAAGGAGGG - Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
953358258 3:42272646-42272668 AAGGGAGTGAAGAGGGCTGTGGG + Intergenic
953607996 3:44424407-44424429 CAGGGTGTGAAGAGGGTGTGAGG - Intergenic
953694332 3:45146097-45146119 CAGGGTGCGGAGGGTGCGGAGGG - Intronic
954434752 3:50490073-50490095 CAGGCTGTGGAGTGGGCGGCAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955059027 3:55481311-55481333 CAGGTTGGGGAGAGGACGGAGGG - Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
957947801 3:87087304-87087326 CAGGGGATGAAGGGGGCGCAGGG + Intergenic
958525934 3:95259006-95259028 CAGGGTCTGAAGTTGGGGGAAGG - Intergenic
961422411 3:126816853-126816875 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
962444571 3:135453115-135453137 GAGGAGGTGAAGAGGGCGGGAGG - Intergenic
962676640 3:137763027-137763049 CAGGGAATGAGGAGGCCGGAAGG - Intergenic
962691468 3:137902864-137902886 AAGGGTGGGGAGAGGGGGGAGGG + Intergenic
962845972 3:139274183-139274205 AAGAGTGTGATGAGGGCTGAGGG - Intronic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963741497 3:149086300-149086322 CAAGAGGTGAAGGGGGCGGAGGG - Exonic
963743048 3:149098231-149098253 CAGCTTGTGAGGAGGGTGGAAGG - Intergenic
963924294 3:150935285-150935307 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968960781 4:3742467-3742489 GGGGGTGTGAAGGGGGAGGAAGG - Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
970983548 4:22129145-22129167 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
971862912 4:32131313-32131335 CTGGGTGTGGAGTGGGGGGAAGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974302696 4:60089259-60089281 CAGGGTGAGAACAGTGCGGGAGG - Intergenic
977081949 4:92541143-92541165 TAGGGTGGGGAGAGGGGGGAGGG + Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
977588500 4:98801487-98801509 AAGGGTGGGAAGAGAGCTGAGGG - Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
979056115 4:115997238-115997260 CAGGGTGTGGGGAGCGGGGAGGG + Intergenic
979625782 4:122843523-122843545 GAGGGTGTGAAGCTGGCGGCAGG + Intronic
980610013 4:135148191-135148213 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
984165549 4:176299494-176299516 CAGGGAGAGAAGGGGTCGGAGGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985620672 5:953165-953187 CGGGGTGGGAAGAGGCAGGAGGG + Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
987721337 5:21636674-21636696 CTGGTTTTGAAGAAGGCGGAAGG - Intergenic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
990550469 5:56871978-56872000 CAGTGTGTGAAGACGGCTGCAGG + Exonic
990643164 5:57811036-57811058 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
992157652 5:73970941-73970963 CAGGGAGTGGGGAGGGAGGAAGG + Intergenic
993385040 5:87252545-87252567 CAGGGAGCGGGGAGGGCGGAAGG + Intergenic
993581660 5:89669338-89669360 GATGGTGTGAAGAGGAAGGAAGG - Intergenic
996311270 5:122108602-122108624 CAGGGTTTGAAGAAGGCAGTGGG - Intergenic
996831653 5:127747247-127747269 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
998179431 5:139926080-139926102 CAGGGTGTGGAGAGAGCCTAGGG + Intronic
998265051 5:140661731-140661753 CAGGGTGTGAGGAGGGGTGTGGG + Intronic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
998912016 5:146970071-146970093 GAGGATGTAAAGAGGGTGGATGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999318827 5:150601024-150601046 CAGGGTGTCAGGGGGGCGGGCGG - Intergenic
1001336186 5:170798937-170798959 AAGGGTGTGGGGAGGGGGGAGGG - Intronic
1001587107 5:172840400-172840422 CAGGGTGTGAAGAGGGTATTTGG + Intronic
1001626754 5:173142720-173142742 GAGGGTGTGTAGAGGGCTGTAGG + Intergenic
1002309827 5:178307590-178307612 CAGGGTCTGATGTGGGCAGAGGG - Intronic
1003431024 6:6037644-6037666 GGGGGTGTGAAGAGCGGGGAGGG - Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004056896 6:12148280-12148302 CGGGGTGTGAAGAGGATGCAGGG - Intronic
1004314004 6:14570588-14570610 CATGGTGGGAAGAGGGCAAAAGG + Intergenic
1004661024 6:17709331-17709353 CATAGAGTGAAGAGGGCAGATGG - Intergenic
1005819882 6:29588957-29588979 ATGGGTGTGAAGAAGGCAGAGGG - Exonic
1006110514 6:31741881-31741903 CAGGGTGTGTAGAGGTCACATGG + Intronic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006814158 6:36839531-36839553 GAGAGAGGGAAGAGGGCGGAGGG + Exonic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007521475 6:42453728-42453750 CTGGGTGTGGATTGGGCGGAGGG + Intergenic
1008409100 6:51152528-51152550 GAGGGTGTGAAGATAGTGGAGGG - Intergenic
1009304403 6:62070480-62070502 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1013169726 6:107625658-107625680 CAGGGAGTGAGGAGGCTGGAAGG + Intronic
1015352894 6:132244025-132244047 CAGTGTTTGAATAGGGCGCAAGG - Intergenic
1016252029 6:142055011-142055033 CAGGGTGTGATGGGGGAGGGGGG + Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018698571 6:166409639-166409661 AGCGGTGTGGAGAGGGCGGAAGG - Intronic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019929048 7:4211362-4211384 CAGGGAGTGAGGAGGCCGGCCGG + Intronic
1025279114 7:57614295-57614317 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1025305617 7:57851205-57851227 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1026149623 7:67776921-67776943 CAGGATGTGCAAAGGGCTGAAGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029420266 7:100468338-100468360 AAGGGTGTGAAGGGAGAGGAAGG + Intronic
1034272125 7:149808457-149808479 CAGGGCGTGTTGGGGGCGGAGGG - Intergenic
1034434022 7:151054564-151054586 GAGGGTGAGAAGTGGGCGGTGGG - Intronic
1035206925 7:157299964-157299986 CAGGGTTAGAGCAGGGCGGAGGG - Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036213833 8:6863366-6863388 CAGGGAGTGGAGAGGCTGGAGGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036690992 8:10944707-10944729 CAGGGTGTGTGCAGGGTGGAGGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037918220 8:22785614-22785636 CAGGGTGTGAAGGAGTCAGATGG + Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042184882 8:66126972-66126994 CAGGGAGTGAAGAGAGTGGGTGG - Exonic
1043835129 8:85036816-85036838 GAGGGAGGGAGGAGGGCGGAGGG + Intergenic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1046527504 8:115399070-115399092 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1046989844 8:120440308-120440330 CAGTGTGTGAAAAGGGCCTAAGG + Intronic
1047096771 8:121634410-121634432 CAGGGGGTGAAGAGAGGGCAAGG - Intronic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1047870663 8:129078099-129078121 GAGGGTGGGAAGAGGGGGGTAGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048657860 8:136562168-136562190 CGTGGTGTGAGGAGGGGGGAGGG + Intergenic
1049328879 8:142039161-142039183 CAGGGTGTGAAAAGGTAGCACGG - Intergenic
1050398132 9:5222179-5222201 CTGGCTGTGAAGAGTGCAGATGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055675392 9:78653926-78653948 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1056065859 9:82933895-82933917 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1056086058 9:83150183-83150205 CAAGGTGTGAAGAGGGAGTGTGG + Intergenic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057786583 9:98092511-98092533 CTGGGAGTGATGGGGGCGGAAGG - Intronic
1059807800 9:117822826-117822848 TAGAGAGTGAAGAGGGTGGAGGG - Intergenic
1061625567 9:131838936-131838958 CAGGGTGTGGAGAGGGAGAGGGG + Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1203630176 Un_KI270750v1:66909-66931 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1185515351 X:695278-695300 CACGGTGGGAAGAGGAGGGATGG - Intergenic
1187635465 X:21223098-21223120 TGGGGTGTGGAGAGGGGGGAGGG + Intergenic
1189609865 X:42720892-42720914 GTGGGTGTGGAGAGGGGGGAGGG - Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1190304818 X:49075947-49075969 TAGGGTGTGAAGATGGGGGGTGG + Intronic
1190887458 X:54542237-54542259 TAGGGTGGGGGGAGGGCGGAGGG - Intronic
1191961991 X:66713686-66713708 TGGGGTGGGGAGAGGGCGGAGGG - Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1195368311 X:104148301-104148323 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1195913568 X:109913829-109913851 TGGGGTGTGAAGAGGGGGGAGGG + Intergenic
1195990297 X:110675757-110675779 GAGGGAGTGAGGAGGGAGGATGG + Exonic
1196398210 X:115288579-115288601 CCGGGTGTGGTGAGGGAGGAAGG + Intergenic
1196724487 X:118884109-118884131 CAGGCTTTGAAGACGGAGGAAGG - Intergenic
1197433210 X:126391991-126392013 CAGGGTGTGGGGTGGGGGGAGGG + Intergenic
1197709311 X:129654491-129654513 GAGAGTGCGAATAGGGCGGAGGG + Intronic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1199264748 X:145817717-145817739 GAGGGAGTGAGGAGGGAGGAGGG - Intergenic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic
1201952476 Y:19580647-19580669 TAGGGTGGGGAGAGGGGGGAGGG - Intergenic
1202013969 Y:20380564-20380586 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1202035464 Y:20629145-20629167 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic