ID: 1026990189

View in Genome Browser
Species Human (GRCh38)
Location 7:74580736-74580758
Sequence CTGGACAGTGACACCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 189}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026990189_1026990196 -9 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990196 7:74580750-74580772 ACTGTCCAGGGGCAGTGGGCAGG 0: 2
1: 0
2: 9
3: 83
4: 461
1026990189_1026990202 12 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990202 7:74580771-74580793 GGAGGTCGCTGCTGCGGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 296
1026990189_1026990200 7 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990200 7:74580766-74580788 GGGCAGGAGGTCGCTGCTGCGGG 0: 1
1: 1
2: 0
3: 47
4: 459
1026990189_1026990203 13 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990203 7:74580772-74580794 GAGGTCGCTGCTGCGGGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 131
1026990189_1026990197 -6 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990197 7:74580753-74580775 GTCCAGGGGCAGTGGGCAGGAGG No data
1026990189_1026990199 6 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990199 7:74580765-74580787 TGGGCAGGAGGTCGCTGCTGCGG No data
1026990189_1026990204 26 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990204 7:74580785-74580807 CGGGGATGGGTTCTTTCAGCAGG No data
1026990189_1026990201 8 Left 1026990189 7:74580736-74580758 CCACCAAAGGTGTCACTGTCCAG 0: 1
1: 1
2: 0
3: 12
4: 189
Right 1026990201 7:74580767-74580789 GGCAGGAGGTCGCTGCTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026990189 Original CRISPR CTGGACAGTGACACCTTTGG TGG (reversed) Intronic
901639073 1:10684240-10684262 CTGGACTGTGATATGTTTGGGGG + Intronic
901666578 1:10829595-10829617 CTGGACATTGACACCATTCCCGG - Intergenic
903138129 1:21322531-21322553 CTGGAGTGTGACACATGTGGGGG - Intronic
904430935 1:30463554-30463576 CTGGACAGTAAAAACTTTGTGGG + Intergenic
904799570 1:33082750-33082772 CAGGACTATGATACCTTTGGAGG - Intronic
904977648 1:34470367-34470389 ATGGACAGTGATACCTTTATTGG + Intergenic
908155931 1:61353133-61353155 CTGGATATTGAGAGCTTTGGGGG - Intronic
908888125 1:68813479-68813501 TTGGACATAGACATCTTTGGAGG - Intergenic
911716840 1:101142849-101142871 TTGGACATGGACATCTTTGGGGG + Intergenic
912011297 1:104966762-104966784 CTGGAGAGAGACACTTTTGCTGG - Intergenic
913254561 1:116942030-116942052 CTGGACAGTGGCATCTGTGCTGG - Exonic
913380720 1:118207557-118207579 CTGGAGAGTGACTGATTTGGGGG + Intergenic
915076080 1:153308893-153308915 CTGGGCAGTGCCACCTTTCCTGG + Intronic
916918898 1:169440324-169440346 CTGGGCAGTTACAAATTTGGGGG - Intronic
919054992 1:192559495-192559517 CTAGACAGTGATTCCTCTGGTGG + Intergenic
919264151 1:195238678-195238700 GTGGTCAGTGGCACCTTTGTTGG - Intergenic
920548496 1:206838569-206838591 GAGGACAGTGAGACCTTGGGAGG + Intronic
921082380 1:211752601-211752623 CACGACAGTTACACCTTCGGTGG + Intronic
922854198 1:228760231-228760253 CTGGACAGGGCAACCTCTGGTGG + Intergenic
1062985559 10:1765351-1765373 TTTGACAGTGTCAGCTTTGGGGG + Intergenic
1066628351 10:37432814-37432836 CTGGACACAGACCCCTTTTGGGG - Intergenic
1071509398 10:86251654-86251676 CTGAAGTGTGACAACTTTGGAGG - Intronic
1074088006 10:110223325-110223347 CTGGCCAGGGACACTTTGGGAGG + Intronic
1074449030 10:113544290-113544312 CTGGGCTGTGCCACATTTGGAGG + Intergenic
1077010343 11:376687-376709 CTGGTCACGTACACCTTTGGGGG - Exonic
1077536813 11:3128463-3128485 CTGGAGAGTGGCAGCATTGGCGG + Intronic
1077791575 11:5446745-5446767 CTGGACAGAGAGTCCTGTGGGGG - Intronic
1078601541 11:12735791-12735813 CTGGACTGTGAAATCTTTGAGGG + Intronic
1078835663 11:15026850-15026872 TTGGGCAGTTACACATTTGGGGG - Intronic
1079098431 11:17526224-17526246 ATGGACAGTCACACCCCTGGTGG + Intronic
1080655738 11:34256627-34256649 CTGTACAGTGTGACATTTGGGGG + Intronic
1084580910 11:70022727-70022749 CAGGACACAGACATCTTTGGGGG - Intergenic
1084950281 11:72661387-72661409 CTGGACAGAGGCAAATTTGGGGG - Intronic
1087078707 11:94149791-94149813 TTGGACAGTGATATCTTTGGGGG + Intronic
1089645836 11:119878097-119878119 CTGGACAGTGCCCCCATTGGAGG - Intergenic
1092021956 12:5210302-5210324 CTGGACAGATACATTTTTGGGGG + Intergenic
1094404453 12:30100439-30100461 CTGCACAGGGAAACTTTTGGAGG - Intergenic
1096470661 12:51873608-51873630 CTGGACTATGACCCCTTGGGTGG - Intergenic
1097908346 12:64943738-64943760 CAGGATAGGGACACATTTGGGGG + Intergenic
1098424398 12:70343679-70343701 GTGGACAATGACACCTATGAGGG - Intronic
1099257470 12:80331690-80331712 TAAGACAGTGACATCTTTGGAGG - Intronic
1100431317 12:94534146-94534168 CGGGACATGGACACCTTTGGGGG - Intergenic
1102364756 12:112322746-112322768 TTTGCCAGTAACACCTTTGGTGG - Intronic
1103746263 12:123126485-123126507 CTGCACACTGACCCCTCTGGTGG + Intronic
1104221367 12:126787664-126787686 CTGTAGCGTGACACCTTTGTAGG - Intergenic
1109023253 13:57126958-57126980 CTGGCCATTGACATATTTGGTGG - Intergenic
1113448416 13:110388060-110388082 CTTGACAGTGCCACCTTTAGAGG + Intronic
1116974542 14:51101095-51101117 CTGGACAGTAACAACTTCTGAGG + Intergenic
1119881982 14:78106858-78106880 TTGGACACAGACACATTTGGAGG + Intergenic
1120761550 14:88290045-88290067 CAGGACATGGACATCTTTGGGGG - Intronic
1121250160 14:92493392-92493414 CTGGAAAGCGACACCTATGTGGG - Intronic
1121640844 14:95483912-95483934 CTGGCCAGGGACTGCTTTGGAGG + Intergenic
1122762193 14:104037440-104037462 CAGGACAGTGACACATGTGGAGG - Intronic
1125348544 15:38743637-38743659 CTGGAAAGTGGCACTTTTAGTGG + Intergenic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1127299321 15:57637213-57637235 CAGGACATGGACATCTTTGGAGG + Intronic
1127974689 15:63988393-63988415 CTTGACAGTGAAGACTTTGGGGG - Intronic
1128539106 15:68512589-68512611 CTGGACATGGAGACATTTGGGGG - Intergenic
1129828381 15:78650675-78650697 CTGGCCAGTGACACCACTTGCGG - Intronic
1129932488 15:79423614-79423636 GTGGACAGTGAGACTTTTGAGGG + Intronic
1133904814 16:10012556-10012578 TAGGACATGGACACCTTTGGGGG - Intronic
1134062002 16:11204951-11204973 CTGGCCAGTGACATCTGAGGAGG - Intergenic
1134422198 16:14104239-14104261 CCAGACAGTCACACCTTTAGGGG - Intronic
1136525016 16:30823929-30823951 GTGGACAGAGACACGCTTGGAGG + Intergenic
1136540683 16:30926212-30926234 CTGCACAGAGACATCTTGGGGGG - Intronic
1138394236 16:56691874-56691896 CTGGACAGACATCCCTTTGGTGG + Intronic
1139359457 16:66388460-66388482 CTGGACAGTCACTGATTTGGAGG + Intronic
1141191038 16:81824772-81824794 TAGGACATGGACACCTTTGGGGG - Intronic
1141827860 16:86493623-86493645 TTGGACAGTCGCAGCTTTGGTGG - Intergenic
1143049920 17:4116688-4116710 CTGGTCAGGGTCACCTTTGCAGG - Intronic
1143868201 17:9939359-9939381 CTGGACAGTCACAGCATTAGCGG + Intronic
1145056620 17:19707546-19707568 CTGCATCGTGACACCTTGGGTGG + Intronic
1146057947 17:29590338-29590360 CTGGACACACACACCTCTGGTGG - Intronic
1147690301 17:42310744-42310766 GTGTACACTGACACCTTTGCAGG + Exonic
1148231508 17:45938189-45938211 CAGCCCAGTGACACCTATGGAGG - Intronic
1148599512 17:48883562-48883584 CTGGAAAGTCACACTCTTGGGGG + Intergenic
1149020826 17:51962296-51962318 TTGCCCAGTCACACCTTTGGGGG + Intronic
1151231626 17:72689133-72689155 CTGCACAGTGACAGCCTTGTAGG + Intronic
1151551556 17:74825243-74825265 CTGGACAGTGGCCCAGTTGGAGG - Intronic
1152071295 17:78135007-78135029 CTGGTGAGTGCCACCCTTGGTGG + Exonic
1152102357 17:78309551-78309573 CGGGACATGGGCACCTTTGGGGG - Intergenic
1156240098 18:35245152-35245174 GAGGACAGTGACATCTTTGTAGG + Intronic
1156281040 18:35638729-35638751 ATAGACAGTGATTCCTTTGGTGG + Intronic
1156357848 18:36358233-36358255 ATGTACATTGGCACCTTTGGTGG + Intronic
1156484314 18:37455424-37455446 GGGTACAGTGACACCCTTGGTGG - Intronic
1157283942 18:46364453-46364475 CTGGAAAGGGACACATTTTGTGG + Intronic
1157327977 18:46682598-46682620 TAGGACATGGACACCTTTGGGGG - Intronic
1157433864 18:47652414-47652436 CAGGACAGTGATTGCTTTGGCGG + Intergenic
1158825605 18:61215261-61215283 CTGGAAATTGAGAACTTTGGCGG + Intergenic
1160450421 18:78960016-78960038 CTGGACAGTGATTCCTCTGATGG - Intergenic
1161050841 19:2163565-2163587 CTGGACCGTGACTCTTATGGGGG + Intronic
1161721749 19:5906554-5906576 CTGGGCAGTTACATCATTGGTGG + Intronic
1161918917 19:7251662-7251684 CAGGACAGTGACTACTCTGGGGG + Intronic
1163160995 19:15464117-15464139 CTGGTCCGTGACTCCTTGGGAGG + Exonic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1164323067 19:24167992-24168014 TTGGATAGTGACACATCTGGAGG + Intergenic
1165280475 19:34793012-34793034 CAGCACAGTGACGCCTTTTGGGG + Intergenic
925091156 2:1156920-1156942 GTGGACAGTGAGACCCTTGGAGG + Intronic
926986383 2:18629079-18629101 GTGGATAGAGACTCCTTTGGTGG + Intergenic
927743020 2:25589789-25589811 GTGGCCAGTGGCACCTTTGCCGG + Intronic
927751884 2:25676686-25676708 CTAGACAGTGACACCAGGGGTGG - Intergenic
928340586 2:30439871-30439893 TAGGACAGGGACATCTTTGGGGG - Intergenic
928671995 2:33611688-33611710 CTGGGCAGTTACAAATTTGGGGG + Intergenic
931395902 2:61888367-61888389 CATGAGAGTGATACCTTTGGCGG + Exonic
940647351 2:156405501-156405523 CAGGACAGTGGCATCTGTGGAGG + Intergenic
942505379 2:176637248-176637270 ATGGACAGTGGCACATTTCGTGG - Intergenic
948024196 2:234764070-234764092 CTAGACTTTGACACCTTTGGAGG + Intergenic
1169327066 20:4684986-4685008 CTGGAAAGCGCCGCCTTTGGAGG - Intergenic
1169960857 20:11158725-11158747 CTGTACATTGTCACCTTTGAAGG - Intergenic
1171142076 20:22752022-22752044 CTGGACAGAGGCTCCCTTGGTGG - Intergenic
1172017298 20:31884871-31884893 CAGGACATGGACATCTTTGGAGG + Intronic
1173124002 20:40320164-40320186 CAGGACAGTGAGACCCTTGCAGG + Intergenic
1173908374 20:46645348-46645370 TAGGACACCGACACCTTTGGTGG + Intronic
1175912073 20:62409775-62409797 CTGGGCACTGACACCTCTGCTGG - Intergenic
1180183617 21:46128954-46128976 CCGCACGGTGGCACCTTTGGGGG - Intronic
1183485772 22:38087063-38087085 CTGGGCAGTGACACCCTTGCCGG + Intronic
1184172491 22:42768253-42768275 CAGGACTGGGACATCTTTGGGGG - Intergenic
950521765 3:13501723-13501745 CTGGCAAGTGACATCTTTGCTGG + Intronic
952046856 3:29331955-29331977 CTGGACTGTGAACTCTTTGGGGG + Intronic
952483632 3:33787586-33787608 CTCAACAGTGACACCTTGTGGGG + Intergenic
955337315 3:58097505-58097527 CTGGACATTGAGTCCTTTCGGGG - Intronic
955593631 3:60564464-60564486 ATGGACAGTGACTCCTCTGATGG + Intronic
961100074 3:124191174-124191196 CTGGACAGTGGAACATGTGGAGG - Intronic
961500172 3:127326769-127326791 CTGGACATAGACTCCTTTGAAGG - Intergenic
967662997 3:192135994-192136016 CTGGCCAGTGAGACCTATGCTGG + Intergenic
969497481 4:7534456-7534478 CGGGACTGGGACATCTTTGGGGG - Intronic
971489794 4:27199351-27199373 CCTGACAGTTACTCCTTTGGAGG + Intergenic
976057529 4:81085617-81085639 CTGGACAGTCACACATTGAGAGG - Intergenic
976821602 4:89213247-89213269 CAGGACTGAGTCACCTTTGGAGG + Intergenic
977591022 4:98827390-98827412 CTGGACAGTGAAAAGATTGGAGG - Intergenic
978963177 4:114709119-114709141 TAGGACATTGACATCTTTGGGGG + Intergenic
982146317 4:152397543-152397565 CTGAACATTAACACCTTTTGGGG + Intronic
983130451 4:164012616-164012638 CTGAACAGTGCCAGCTATGGTGG + Intronic
984915235 4:184717707-184717729 CTAGACAGTGAACCCTTTGAAGG - Intronic
987255972 5:16151383-16151405 CTTGACAATGACACCTTAGGGGG - Intronic
989762982 5:45042486-45042508 CTGGACATTCACCCCTCTGGAGG + Intergenic
991160571 5:63495206-63495228 CTGGAAAGGGCCAGCTTTGGGGG - Intergenic
991164646 5:63550329-63550351 CTGCACAGTGACAGTTTAGGTGG + Intergenic
993050647 5:82922444-82922466 CTGCACAGTAACACCACTGGAGG - Intergenic
993752614 5:91689789-91689811 TTGAACAGTGAGTCCTTTGGAGG + Intergenic
994048470 5:95335605-95335627 CAGAATAGTGCCACCTTTGGAGG + Intergenic
994641270 5:102412307-102412329 ATGGCCTGTGACACCTTGGGAGG - Intronic
997166017 5:131660732-131660754 CTGGGCAGTTACAAATTTGGGGG + Intronic
997633179 5:135385397-135385419 CTGGACAGGAAGCCCTTTGGGGG + Intronic
998129813 5:139646086-139646108 CTGGAAATTAACACCTTGGGAGG - Intergenic
998214201 5:140225237-140225259 ATGGGCAGTGACACCTATGTAGG - Intronic
999446038 5:151640111-151640133 CAGGACATGGACATCTTTGGGGG + Intergenic
1000049074 5:157546586-157546608 ATGGAAAGGGACTCCTTTGGAGG - Intronic
1001316080 5:170642071-170642093 TTGGATTGTGACATCTTTGGAGG + Intronic
1002110571 5:176907571-176907593 GTGTACAGTGACTCCTTTGTCGG + Intronic
1002534446 5:179868569-179868591 CTGGCCAGTGGGCCCTTTGGGGG + Intronic
1002629203 5:180558369-180558391 GTGGAGAGTGAGACCTTGGGCGG + Intronic
1005396888 6:25391756-25391778 CTGGACACTGACATCTGTAGAGG + Intronic
1005439772 6:25854512-25854534 CTGGACAGTGAGCTCTTTGAGGG - Intronic
1006245138 6:32727009-32727031 CTGGACATTGTCTTCTTTGGGGG + Intergenic
1006739536 6:36297507-36297529 ATGGAGGGTGACACCTTTTGGGG - Intronic
1007132374 6:39487554-39487576 CTTGGCATTGACACCTGTGGGGG - Intronic
1008782817 6:55127386-55127408 TTGGACAGTGAATGCTTTGGAGG - Intronic
1011375865 6:86686354-86686376 CTCGAGAGTTACACATTTGGGGG + Intergenic
1013022319 6:106232255-106232277 TTGGATAGTGACAGCTCTGGAGG - Intronic
1015783198 6:136892977-136892999 GTGGCCAGAGACACCTTTGAAGG + Intronic
1016432275 6:143998830-143998852 CAGGAGAGTGAAACCTTTAGGGG + Intronic
1017493070 6:154960722-154960744 TTGGACAGAGACAGCTGTGGGGG + Intronic
1018453189 6:163928084-163928106 CTGAAAAGTGACACCTTCTGTGG + Intergenic
1019757272 7:2781125-2781147 CTGGATACTCACACCTTTGTAGG + Intronic
1020365541 7:7377358-7377380 CTGGACTGTGAATCCTTTGAGGG - Intronic
1022662396 7:32379189-32379211 CTGTACTGTGACACCCTTGAGGG + Intergenic
1022708239 7:32826421-32826443 CAGGAAAGCGACAACTTTGGGGG + Intergenic
1022914941 7:34939067-34939089 CAGGAAAGTGACAACTTTGGGGG - Intronic
1023855481 7:44180847-44180869 TTGGACAGTGACTCCTGTTGGGG - Intronic
1024283382 7:47737354-47737376 CAGGACATGGACATCTTTGGGGG + Intronic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1026610484 7:71855337-71855359 CTGGACAATGACTGCTTTAGTGG + Intronic
1026990189 7:74580736-74580758 CTGGACAGTGACACCTTTGGTGG - Intronic
1031809370 7:126346825-126346847 ATGGAAAGTGACATATTTGGGGG + Intergenic
1032886727 7:136148322-136148344 CTGTACAGAGACATTTTTGGAGG - Intergenic
1035833753 8:2727138-2727160 CTGGACACTCACAGTTTTGGGGG - Intergenic
1036961594 8:13250047-13250069 CTGGACAGTGAGACCCTTCAGGG + Intronic
1037334049 8:17774824-17774846 GTGGCCACTGACACCTTTGATGG - Intronic
1038008890 8:23458017-23458039 CTTGACATTTACACCTTTGCCGG + Intergenic
1040379893 8:46862371-46862393 CTGGACAGTGACATATTTCTAGG + Intergenic
1045378443 8:101599445-101599467 CTGCACAGAGACGCCTTTGGGGG - Intronic
1048006377 8:130422534-130422556 CTTGACAGAGACAGCTTAGGAGG - Intronic
1050649923 9:7765118-7765140 ATAGACAGTGACCCCTCTGGTGG + Intergenic
1051367084 9:16328883-16328905 CTGGATAGTGCCATTTTTGGAGG + Intergenic
1051618718 9:19031024-19031046 ATGGAAAGTGACTCCTTTGCAGG + Intronic
1056544282 9:87601071-87601093 CTGGATCGGGACTCCTTTGGGGG - Intronic
1056792311 9:89633688-89633710 CAGGGCTGAGACACCTTTGGTGG + Intergenic
1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG + Intergenic
1058639669 9:107070725-107070747 CTGGACTGTGCCACCCTTTGTGG - Intergenic
1062641449 9:137520809-137520831 CTGAACTGTGACGCGTTTGGAGG - Intronic
1186085877 X:5990393-5990415 CTGCACAGAGACACCCTGGGCGG + Intronic
1186660098 X:11660853-11660875 CTGGACAGTGAAGCCTTTCAAGG + Intronic
1186771588 X:12823404-12823426 ATGGACACTGACACATTTTGGGG + Intronic
1188025325 X:25202310-25202332 CTGGACAAGGACACTTTTGCTGG + Intergenic
1188316764 X:28684022-28684044 TTGGACATGGACATCTTTGGAGG + Intronic
1188317627 X:28694053-28694075 CTGCACAGAGTCTCCTTTGGTGG + Intronic
1190103026 X:47537304-47537326 CTGGAAGGTGTCACCATTGGAGG + Intergenic
1191676482 X:63796944-63796966 CTGCAGAGTGACACCTTTTGGGG + Intergenic
1191929583 X:66355875-66355897 CTCAACAGTGACACGTTTGAAGG - Intergenic
1192447701 X:71223164-71223186 CTGCACAATGAGACCTTTGTGGG - Intronic
1200702498 Y:6414065-6414087 CTGAAGAGTGACACTTTTGCAGG + Intergenic
1201031613 Y:9750633-9750655 CTGAAGAGTGACACTTTTGCAGG - Intergenic