ID: 1026990480

View in Genome Browser
Species Human (GRCh38)
Location 7:74582342-74582364
Sequence TGCACCAGAGGCAGCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026990480_1026990486 6 Left 1026990480 7:74582342-74582364 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1026990486 7:74582371-74582393 GTTCCCAGAAGATCTGGGATGGG 0: 1
1: 1
2: 1
3: 18
4: 208
1026990480_1026990483 0 Left 1026990480 7:74582342-74582364 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1026990483 7:74582365-74582387 CTCACAGTTCCCAGAAGATCTGG 0: 1
1: 1
2: 3
3: 35
4: 298
1026990480_1026990489 14 Left 1026990480 7:74582342-74582364 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1026990489 7:74582379-74582401 AAGATCTGGGATGGGACTACAGG No data
1026990480_1026990484 1 Left 1026990480 7:74582342-74582364 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1026990484 7:74582366-74582388 TCACAGTTCCCAGAAGATCTGGG 0: 1
1: 1
2: 0
3: 15
4: 192
1026990480_1026990485 5 Left 1026990480 7:74582342-74582364 CCCAAGGAGCTGCCTCTGGTGCA No data
Right 1026990485 7:74582370-74582392 AGTTCCCAGAAGATCTGGGATGG 0: 1
1: 2
2: 3
3: 38
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026990480 Original CRISPR TGCACCAGAGGCAGCTCCTT GGG (reversed) Intronic