ID: 1026991584

View in Genome Browser
Species Human (GRCh38)
Location 7:74589015-74589037
Sequence GTTGTTTTGTGCCCAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 147}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026991581_1026991584 -5 Left 1026991581 7:74588997-74589019 CCTGCCTCTTCTCTTTAGGTTGT 0: 1
1: 0
2: 0
3: 23
4: 306
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991570_1026991584 29 Left 1026991570 7:74588963-74588985 CCCCCTCTGGCTGGGAGCCCCTC 0: 1
1: 1
2: 6
3: 51
4: 405
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991576_1026991584 12 Left 1026991576 7:74588980-74589002 CCCCTCAGGGAAGCAGCCCTGCC 0: 1
1: 0
2: 2
3: 45
4: 391
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991580_1026991584 -4 Left 1026991580 7:74588996-74589018 CCCTGCCTCTTCTCTTTAGGTTG 0: 1
1: 0
2: 1
3: 23
4: 278
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991572_1026991584 27 Left 1026991572 7:74588965-74588987 CCCTCTGGCTGGGAGCCCCTCAG 0: 1
1: 1
2: 3
3: 47
4: 371
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991573_1026991584 26 Left 1026991573 7:74588966-74588988 CCTCTGGCTGGGAGCCCCTCAGG 0: 1
1: 2
2: 5
3: 39
4: 311
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991582_1026991584 -9 Left 1026991582 7:74589001-74589023 CCTCTTCTCTTTAGGTTGTTTTG 0: 1
1: 0
2: 2
3: 29
4: 362
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991578_1026991584 10 Left 1026991578 7:74588982-74589004 CCTCAGGGAAGCAGCCCTGCCTC 0: 1
1: 1
2: 6
3: 81
4: 468
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991577_1026991584 11 Left 1026991577 7:74588981-74589003 CCCTCAGGGAAGCAGCCCTGCCT 0: 1
1: 1
2: 5
3: 47
4: 346
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147
1026991571_1026991584 28 Left 1026991571 7:74588964-74588986 CCCCTCTGGCTGGGAGCCCCTCA 0: 1
1: 2
2: 2
3: 32
4: 305
Right 1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG 0: 2
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026991584 Original CRISPR GTTGTTTTGTGCCCAACACA GGG Intronic
908152615 1:61318804-61318826 GTTGGTTTTTGCCCGACTCAAGG + Intronic
909554450 1:76937969-76937991 GTTCTTTTCTTCCCTACACAAGG - Intronic
909579164 1:77213303-77213325 CTTGTTTTGTGCCTACCACATGG - Intronic
917162144 1:172069714-172069736 GTTATTTTGTGGCGAGCACATGG - Intronic
921847387 1:219898536-219898558 CGTGTTTTGTGACCAAAACAGGG - Intronic
921874540 1:220179609-220179631 ATTGTTTTGTGGCTAACATATGG - Intronic
922053182 1:222014566-222014588 GTTGTTTTCTCCTCTACACATGG + Intergenic
1065615752 10:27521191-27521213 CTTGTTTTGTAGCCAACATATGG + Intronic
1067629444 10:47950571-47950593 GTTGTTTTCTGCCCCAGATATGG - Intergenic
1067906746 10:50299027-50299049 CTTGTTTTGTGTCCTACATATGG - Intergenic
1069269755 10:66511763-66511785 GTTGTTTTGGGCCTAACATAGGG + Intronic
1071880731 10:89895187-89895209 TTTGTTTTGTGCCTATCATATGG + Intergenic
1072341561 10:94457338-94457360 GTTTTTTTGTAGGCAACACATGG + Intronic
1078676161 11:13416345-13416367 GTTGTTTTTTGCCCCAGACAGGG - Intronic
1079400881 11:20105534-20105556 GGTGCTTTGTGCCAACCACACGG + Exonic
1084290870 11:68165967-68165989 GATGTTTTCAGCCCAACACTGGG - Intronic
1085846140 11:80067614-80067636 TTTATTTTGTGCCAAGCACAGGG + Intergenic
1086383099 11:86279442-86279464 GTTATTTTGTCTCCAACATAAGG + Intergenic
1087133808 11:94694320-94694342 ATTGTTTTCTGCCTAACCCAGGG - Intergenic
1090063507 11:123484138-123484160 GATGTTTGGTGCACAGCACAGGG - Intergenic
1092862479 12:12730796-12730818 GTTGTATTTAGCCCAATACATGG + Intronic
1093900924 12:24631168-24631190 TTTGCTTTTTTCCCAACACAAGG - Intergenic
1095048191 12:37533405-37533427 ATTGTTCTGTGGCCAACCCAGGG + Intergenic
1095737076 12:45569054-45569076 CTTTTTTTTTACCCAACACATGG - Intergenic
1099553277 12:84074893-84074915 TTTGTTATGTGCCAAACACTAGG - Intergenic
1103214817 12:119193879-119193901 CTTGTTTTGTCCCCAACCCTAGG + Exonic
1103670152 12:122607537-122607559 GTTGTGTTGTGCCCTCCTCAGGG + Intronic
1106181009 13:27369335-27369357 TTTCCTTTGGGCCCAACACAAGG + Intergenic
1107972965 13:45661781-45661803 GTTTTTTTGTGCCCAGTACTTGG - Intergenic
1111522023 13:89417637-89417659 GTTGTTTTGTGATCACCTCATGG + Intergenic
1113072758 13:106437755-106437777 GTTGTTCTTTACCCTACACAAGG + Intergenic
1121560181 14:94868702-94868724 CTTGTAATGTGCCCAACAGATGG - Intergenic
1121697582 14:95926361-95926383 GTTGTATTGTGATCAATACAGGG - Intergenic
1122140207 14:99659177-99659199 GATGTGTTGTGTCCAACGCATGG + Intronic
1122231702 14:100309309-100309331 TCTGTCTTGTCCCCAACACAGGG - Intergenic
1123940476 15:25214235-25214257 GTTTTTTTCAGCCCCACACAAGG + Intergenic
1123964889 15:25445051-25445073 GGTGTTTAGTGCCTGACACATGG + Intergenic
1124222068 15:27858786-27858808 ATTGTTTTGTGCCCTACATGTGG - Intronic
1124782253 15:32647307-32647329 GTTGTTCACTGCCCAACACATGG + Intronic
1125081751 15:35682351-35682373 TTTGTTTTGGGCCAAATACATGG + Intergenic
1131887011 15:96926834-96926856 GTGGTTTTGTCCCCAAAACTAGG - Intergenic
1132769943 16:1556246-1556268 GATGTTTTCTGCCCAACTCAAGG - Intronic
1158616318 18:58991000-58991022 CCTGTTTTGTGCCCAACACACGG - Intergenic
1158979409 18:62744560-62744582 GTTTTTTAGTGCCTAACAGAAGG + Intronic
1161701896 19:5800338-5800360 TTTGTTCTGTGCCCAGCACTGGG - Intergenic
1162034879 19:7933395-7933417 GCTGTCTTGTGCCCAATGCAGGG + Intronic
1165716860 19:38051982-38052004 ATTCTTTGGTGACCAACACATGG + Intronic
1168555359 19:57334240-57334262 TTTGTTTGCTGTCCAACACAAGG - Intergenic
928848082 2:35705145-35705167 ATTGCCATGTGCCCAACACATGG + Intergenic
932669108 2:73721251-73721273 GTTCTTCCGAGCCCAACACAGGG - Intergenic
933340522 2:81019848-81019870 TTTGTTTTGTTTGCAACACAGGG - Intergenic
936973847 2:118199956-118199978 ATTGTAATGTTCCCAACACAAGG - Intergenic
937440578 2:121912109-121912131 ATTGTTTTGTTGCCTACACAAGG + Intergenic
941263754 2:163332726-163332748 TTTGTTTTGTTCTCAACACCAGG + Intergenic
942822744 2:180135307-180135329 CTTTTTCTGTGCCCAACACATGG - Intergenic
943404291 2:187460885-187460907 GGTGTGTTGTACCCAACAAAGGG - Intergenic
944097597 2:195986315-195986337 CTAGTCTTGTGCCTAACACATGG + Intronic
948162420 2:235835685-235835707 GTTGTAAAGTGCCCAGCACAGGG - Intronic
1171542729 20:25976882-25976904 ATTGTTCTGTGACCAACGCAGGG + Intergenic
1171798329 20:29583642-29583664 ATTGTTCTGTGGCCAACCCAGGG - Intergenic
1171845764 20:30273531-30273553 ATTGTTCTGTGGCCAACCCAGGG + Intergenic
1177528111 21:22324255-22324277 GTTGAAATGTTCCCAACACAAGG - Intergenic
1184994633 22:48196553-48196575 GTTGTGTTGTGCAAAATACATGG - Intergenic
1185373175 22:50470157-50470179 GTGGTTTGGGGCCAAACACAAGG - Intronic
952828269 3:37541972-37541994 CATGGTTTATGCCCAACACAAGG - Intronic
955892723 3:63666979-63667001 TTTGTTTTTTGACAAACACAGGG + Intronic
957393452 3:79609736-79609758 GTCGTTTTGTGACCAACTTATGG - Intronic
957432308 3:80126499-80126521 GTTGTAATGTTCCTAACACAAGG + Intergenic
960168597 3:114432415-114432437 GTTGTTTTCTTCTCAACACATGG - Intronic
961416515 3:126762533-126762555 CTTGTTTTGTGCCCAATATATGG + Intronic
962501834 3:136002467-136002489 GTTGTTCAGTGCCAAACACTGGG - Exonic
964176905 3:153834779-153834801 GTTATAATGTGCTCAACACAAGG - Intergenic
964534923 3:157710277-157710299 GTTGTTCTGTGCTCATAACAAGG + Intergenic
964635158 3:158850420-158850442 GTTGGTTTGTGCAGAAGACAGGG - Intergenic
971113093 4:23612015-23612037 TTTTTTTTGTACCCAAAACAAGG + Intergenic
974677634 4:65114709-65114731 CTTGTTTTGTGCCTAACATATGG - Intergenic
976413672 4:84746747-84746769 ACTGTTTTGTGCCAGACACAGGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
978343299 4:107739769-107739791 GTTTCATTGTTCCCAACACAAGG - Intergenic
979137227 4:117125017-117125039 GTTTTTTTCTGCCTACCACAGGG + Intergenic
980515114 4:133847275-133847297 TTTTTTTTTTCCCCAACACATGG - Intergenic
981063990 4:140461946-140461968 GTTGCTGTATGCCCAACCCAAGG - Exonic
981880679 4:149607745-149607767 TTTGTTTTGTGGCTATCACAAGG - Intergenic
981947733 4:150368381-150368403 GTTGTTTTATACCCACCATATGG + Intronic
982521694 4:156425329-156425351 GTTGATTCTTGACCAACACAGGG - Intergenic
984368984 4:178836543-178836565 ATTGTTTTGTAGCCAACAAATGG - Intergenic
984813309 4:183814757-183814779 TTTGTGTTGTACCCAACAAACGG - Intergenic
986204688 5:5612363-5612385 CTGCTTTTGTGCCCAAAACAAGG - Intergenic
987280973 5:16413353-16413375 TTTGTTCTGTGTCTAACACAAGG - Intergenic
989412121 5:41132247-41132269 GTTGTGGTCTGGCCAACACATGG - Intergenic
992288915 5:75264523-75264545 GTTGTTTTGTGCATCACAGATGG + Intergenic
996476515 5:123928725-123928747 GAGGTTTTTTTCCCAACACATGG + Intergenic
996752363 5:126901774-126901796 GGTGCCTTGTACCCAACACAGGG + Intronic
996827615 5:127703140-127703162 GTGGTTTTGTGCTCAAACCAAGG - Intergenic
997762029 5:136458639-136458661 GTGGTTTCCTTCCCAACACATGG + Intergenic
1000714990 5:164631552-164631574 GTTGATCTGTGCACAACACTTGG + Intergenic
1003046823 6:2740837-2740859 GTCATTTTCTGCCCACCACATGG - Intronic
1003291146 6:4779215-4779237 GATGTTTTGTGGCCAAGTCAAGG + Intronic
1003669939 6:8147916-8147938 GTTACTTGGTGCCCATCACATGG - Intergenic
1004227767 6:13802843-13802865 GTTGTTTTATGTCCAGCATAAGG + Intronic
1004850437 6:19693119-19693141 GGTGTTTTGTGCCCATCTCAGGG + Intergenic
1007021067 6:38522037-38522059 GTTGTCTTGTGCCTAGGACAGGG - Intronic
1007765568 6:44157868-44157890 GTTATTATGTGCCAAACACTGGG - Intergenic
1007825431 6:44596255-44596277 GGTGTTGTGTGCCTCACACAAGG - Intergenic
1008777520 6:55059274-55059296 CTTGTTTTGTGGCCAGCATATGG + Intergenic
1008935094 6:56982849-56982871 TTAGTTTTGTGCCAAAGACAGGG - Intronic
1011026000 6:82869759-82869781 TTTGCATTCTGCCCAACACATGG - Intergenic
1011736987 6:90320894-90320916 GTAGTTTTTTGCAAAACACAGGG - Intergenic
1011933924 6:92751295-92751317 CTTTTTTTGTGGCTAACACATGG + Intergenic
1013835556 6:114330829-114330851 GTCTTTTTTTACCCAACACAAGG - Intronic
1013971631 6:116026715-116026737 GTTGCTTTGTTCACAACAAAAGG + Intronic
1014073650 6:117212338-117212360 CTTGTTTTGTGGCTAACATAGGG + Intergenic
1014216734 6:118758968-118758990 GTTTTTTTTTCCCCAACATAGGG + Intergenic
1015203977 6:130614330-130614352 TTTGTTTTGTGCCAAATACTGGG + Intergenic
1017623467 6:156324138-156324160 TTTGTTTTGTGCCTAAGATATGG + Intergenic
1017924702 6:158901047-158901069 CTTATTTTTTGCCAAACACATGG + Intronic
1020006984 7:4788392-4788414 GGTGCTTTGTGTCCCACACAAGG + Intronic
1024316998 7:48029683-48029705 GTTGTTATATGCACATCACAAGG + Intergenic
1024386379 7:48756684-48756706 AAGGTTTTGTGGCCAACACATGG + Intergenic
1024946931 7:54817864-54817886 TTTGTTTTGTGCCTATCATATGG + Intergenic
1025294105 7:57761990-57762012 ATTGTTCTGTGGCCAACCCAGGG + Intergenic
1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG + Intergenic
1026117649 7:67509533-67509555 GTTGTGTTGACCCCATCACATGG - Intergenic
1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG + Intronic
1028092044 7:86714940-86714962 GTTGTTTTGTGACAATCACATGG - Intronic
1028448964 7:90958548-90958570 GATCTTTTTTTCCCAACACAGGG + Intronic
1029669923 7:102022805-102022827 GTTGCTTTTTGCCCAATAGATGG + Intronic
1030609145 7:111669757-111669779 GTTATTTTGTACCCAACCCATGG + Intergenic
1031666043 7:124483081-124483103 GTTCTTTTGTGGGCAACCCAAGG + Intergenic
1032111833 7:129082528-129082550 TTTCCTTTGTGCCCAATACATGG + Intergenic
1033685774 7:143640106-143640128 GTTGTTTTGTGGCCAAGAGGAGG - Intronic
1033689969 7:143727209-143727231 GTTGTTTTGTGGCCAAGAGGAGG + Intronic
1033698840 7:143817515-143817537 GTTGTTTTGTGGCCAAGAGGAGG + Intergenic
1034669498 7:152847334-152847356 GATGTTTGCTGCCCATCACAGGG + Intronic
1037394197 8:18424734-18424756 ATTGTTTTATTCCCAACACTCGG - Intergenic
1037394315 8:18426074-18426096 ATTGTTTTATTCCCAACACTTGG - Intergenic
1038100099 8:24363806-24363828 GTTCTTTTGTGCCCATGGCAGGG + Intergenic
1039226814 8:35397245-35397267 GTTGGTATGTGCCCAGCAGAGGG - Intronic
1040044858 8:42952358-42952380 TTTGTTTTGTCCCCACCCCATGG + Intronic
1041661092 8:60401885-60401907 GGTGTTCTGAGCCCAGCACAGGG - Intergenic
1041714141 8:60918486-60918508 GCTGTGATGTGCCCAACAGATGG + Intergenic
1042776265 8:72435369-72435391 GTGGTTGTGTTCCCAACAGAGGG - Intergenic
1045086138 8:98687898-98687920 GAGGTTTTGTTCCCATCACAGGG - Intronic
1050676466 9:8060998-8061020 GTTGTTTTGTGTTAAACATATGG + Intergenic
1054162312 9:61682313-61682335 ATTGTTCTGTGGCCAACCCAGGG - Intergenic
1059477062 9:114555775-114555797 AATGTTTTGTGCCTAGCACAAGG - Intergenic
1185815583 X:3152152-3152174 GCAGTTCTGTGCCCAAGACACGG + Intergenic
1187180275 X:16937416-16937438 GTTGTTGTGTGAACATCACAGGG + Intergenic
1188478300 X:30610757-30610779 GTAGTACTGTGCCCAACACATGG - Intergenic
1189947377 X:46193057-46193079 TTTGCTGTGTTCCCAACACACGG - Intergenic
1193425569 X:81337489-81337511 TTTGTTTTTTCCCCAACCCAAGG + Intergenic
1194211213 X:91072002-91072024 GTTCTCTTGTGCCCCTCACAGGG + Intergenic
1194883016 X:99277259-99277281 CTTGTTTTGTGACCTACATATGG - Intergenic
1196661196 X:118270899-118270921 ATTGTAATGTTCCCAACACAAGG + Intergenic
1197661267 X:129175910-129175932 TTTGTTTTGTGATCAACATATGG + Intergenic
1198250723 X:134877075-134877097 GTTCTTGTGTGCCCAACCCTAGG + Intergenic
1200428180 Y:3045654-3045676 GATGTCTTCTGCCCTACACATGG - Intergenic
1200696341 Y:6364366-6364388 GTTGCTTTGACTCCAACACAAGG - Intergenic
1200697610 Y:6374884-6374906 ACAGTTTTGTGGCCAACACAGGG - Intergenic
1200911501 Y:8535325-8535347 ATTGTCTTGTGGCCAACCCAGGG + Intergenic
1200914944 Y:8563422-8563444 ATTGTCTTGTGGCCAACCCAAGG + Intergenic
1200922765 Y:8627905-8627927 TTTATTTTGTGGCCAACACAGGG + Intergenic
1201036502 Y:9789815-9789837 ACAGTTTTGTGGCCAACACAGGG + Intergenic
1201037773 Y:9800334-9800356 GTTGCTTTGACTCCAACACAAGG + Intergenic