ID: 1026997540

View in Genome Browser
Species Human (GRCh38)
Location 7:74628138-74628160
Sequence GGGGTCTGTGATCTGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026997540_1026997559 25 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997559 7:74628186-74628208 CCATTGCAACAATCCCTCCGGGG No data
1026997540_1026997548 2 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997548 7:74628163-74628185 GGAGCCTTCGCCCCACCCCAGGG No data
1026997540_1026997560 28 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997560 7:74628189-74628211 TTGCAACAATCCCTCCGGGGTGG No data
1026997540_1026997547 1 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997547 7:74628162-74628184 GGGAGCCTTCGCCCCACCCCAGG No data
1026997540_1026997561 29 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997540_1026997556 23 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997556 7:74628184-74628206 GGCCATTGCAACAATCCCTCCGG No data
1026997540_1026997562 30 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997562 7:74628191-74628213 GCAACAATCCCTCCGGGGTGGGG No data
1026997540_1026997557 24 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997557 7:74628185-74628207 GCCATTGCAACAATCCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026997540 Original CRISPR GGGGTCTGTGATCTGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr