ID: 1026997549

View in Genome Browser
Species Human (GRCh38)
Location 7:74628167-74628189
Sequence ATGGCCCTGGGGTGGGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026997549_1026997561 0 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997549_1026997556 -6 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997556 7:74628184-74628206 GGCCATTGCAACAATCCCTCCGG No data
1026997549_1026997560 -1 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997560 7:74628189-74628211 TTGCAACAATCCCTCCGGGGTGG No data
1026997549_1026997559 -4 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997559 7:74628186-74628208 CCATTGCAACAATCCCTCCGGGG No data
1026997549_1026997557 -5 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997557 7:74628185-74628207 GCCATTGCAACAATCCCTCCGGG No data
1026997549_1026997564 7 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997564 7:74628197-74628219 ATCCCTCCGGGGTGGGGCATGGG No data
1026997549_1026997562 1 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997562 7:74628191-74628213 GCAACAATCCCTCCGGGGTGGGG No data
1026997549_1026997563 6 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997563 7:74628196-74628218 AATCCCTCCGGGGTGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026997549 Original CRISPR ATGGCCCTGGGGTGGGGCGA AGG (reversed) Intergenic
No off target data available for this crispr