ID: 1026997552

View in Genome Browser
Species Human (GRCh38)
Location 7:74628175-74628197
Sequence TTGTTGCAATGGCCCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026997552_1026997564 -1 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997564 7:74628197-74628219 ATCCCTCCGGGGTGGGGCATGGG No data
1026997552_1026997563 -2 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997563 7:74628196-74628218 AATCCCTCCGGGGTGGGGCATGG No data
1026997552_1026997561 -8 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997552_1026997562 -7 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997562 7:74628191-74628213 GCAACAATCCCTCCGGGGTGGGG No data
1026997552_1026997560 -9 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997560 7:74628189-74628211 TTGCAACAATCCCTCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026997552 Original CRISPR TTGTTGCAATGGCCCTGGGG TGG (reversed) Intergenic
No off target data available for this crispr