ID: 1026997561

View in Genome Browser
Species Human (GRCh38)
Location 7:74628190-74628212
Sequence TGCAACAATCCCTCCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026997549_1026997561 0 Left 1026997549 7:74628167-74628189 CCTTCGCCCCACCCCAGGGCCAT No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997544_1026997561 10 Left 1026997544 7:74628157-74628179 CCCCGGGGAGCCTTCGCCCCACC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997551_1026997561 -7 Left 1026997551 7:74628174-74628196 CCCACCCCAGGGCCATTGCAACA No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997545_1026997561 9 Left 1026997545 7:74628158-74628180 CCCGGGGAGCCTTCGCCCCACCC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997550_1026997561 -6 Left 1026997550 7:74628173-74628195 CCCCACCCCAGGGCCATTGCAAC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997546_1026997561 8 Left 1026997546 7:74628159-74628181 CCGGGGAGCCTTCGCCCCACCCC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997552_1026997561 -8 Left 1026997552 7:74628175-74628197 CCACCCCAGGGCCATTGCAACAA No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997539_1026997561 30 Left 1026997539 7:74628137-74628159 CCCTGGCTGCAGATCACAGACCC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data
1026997540_1026997561 29 Left 1026997540 7:74628138-74628160 CCTGGCTGCAGATCACAGACCCC No data
Right 1026997561 7:74628190-74628212 TGCAACAATCCCTCCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026997561 Original CRISPR TGCAACAATCCCTCCGGGGT GGG Intergenic
No off target data available for this crispr