ID: 1026998562

View in Genome Browser
Species Human (GRCh38)
Location 7:74635604-74635626
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026998562_1026998567 9 Left 1026998562 7:74635604-74635626 CCTGTATCTTGATTATGGTGGGG No data
Right 1026998567 7:74635636-74635658 GTGAGTGAAAATATTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026998562 Original CRISPR CCCCACCATAATCAAGATAC AGG (reversed) Intergenic
No off target data available for this crispr