ID: 1027008968

View in Genome Browser
Species Human (GRCh38)
Location 7:74725299-74725321
Sequence GTTTTAAGTCATATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027008968_1027008972 11 Left 1027008968 7:74725299-74725321 CCATGTTCCATATGACTTAAAAC 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1027008972 7:74725333-74725355 AATTAATAAGTTTATGAAACAGG 0: 1
1: 0
2: 5
3: 50
4: 513
1027008968_1027008973 12 Left 1027008968 7:74725299-74725321 CCATGTTCCATATGACTTAAAAC 0: 1
1: 0
2: 1
3: 13
4: 167
Right 1027008973 7:74725334-74725356 ATTAATAAGTTTATGAAACAGGG 0: 1
1: 0
2: 3
3: 51
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027008968 Original CRISPR GTTTTAAGTCATATGGAACA TGG (reversed) Intronic
907003045 1:50882155-50882177 GGCTTAAGTAATATGGAACTTGG - Intronic
909696395 1:78472864-78472886 GTGTTAAGTTTTATGGAAGATGG + Intronic
910889325 1:92000778-92000800 GTTTTCTGTCATCTGCAACATGG - Intronic
911091387 1:94019916-94019938 GTCTTAATCCATATGGACCAAGG + Intronic
912090453 1:106067253-106067275 GTATAAAGGCATATTGAACAAGG + Intergenic
912587535 1:110780483-110780505 CTTTTAAGTCATGTTGATCATGG - Intergenic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918198262 1:182242923-182242945 GCCTTAAGTCAAATGGAACTTGG + Intergenic
920805540 1:209230737-209230759 GTTTAGTGTCATATGGAACTGGG + Intergenic
921559875 1:216644256-216644278 CTTTTACTTCATCTGGAACATGG + Intronic
923430004 1:233910861-233910883 GTTTTAAGTCATTTGTAGAATGG + Intronic
1063021425 10:2132775-2132797 GTTTTATGTCATCAGGAAAATGG + Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1065440070 10:25743906-25743928 TTTTAAAAGCATATGGAACATGG + Intergenic
1066302927 10:34112774-34112796 ATTTTAGGCCATATGGAAAATGG - Intronic
1071534531 10:86416960-86416982 GTTTAAAGACACCTGGAACAGGG - Intergenic
1072810026 10:98454378-98454400 GATTTAAGTCATATGGAACTTGG + Intergenic
1075142127 10:119848283-119848305 CACTTAAGTCATATGGCACAGGG - Intronic
1076644229 10:131941363-131941385 GTCTTAAATTAGATGGAACATGG + Intronic
1079569311 11:21922743-21922765 GCTTAAAGTCACATGGTACATGG + Intergenic
1080170446 11:29295756-29295778 GAATTAAATGATATGGAACACGG + Intergenic
1082265965 11:50118826-50118848 TTTTTGAGTCATGTTGAACAGGG - Intergenic
1082290123 11:50359746-50359768 TTTTTGAGTCATGTTGAACAGGG + Intergenic
1087758581 11:102081107-102081129 GTTCTTATTCATATAGAACATGG - Intronic
1087892193 11:103547977-103547999 GTTTTAAGTCAGATGGACGTGGG + Intergenic
1087949441 11:104202618-104202640 GTTTTCAGTCTTATGAGACATGG - Intergenic
1088392967 11:109335528-109335550 GTTTTAAGTCTTCAGGATCATGG + Intergenic
1088962633 11:114684749-114684771 ATTTTAATTCATATGGAAAAAGG + Intronic
1089938261 11:122388135-122388157 GTTTGAAGGCAAATGGAATATGG + Intergenic
1090158273 11:124464472-124464494 ATTTTAAATCATATGGATCTTGG + Intergenic
1092591976 12:9960447-9960469 GTTTTAGGCCACATTGAACAAGG - Intronic
1096019304 12:48308862-48308884 ATTTTAAGGCAAATGGATCATGG + Intergenic
1097303562 12:58043986-58044008 GTTTTAAGGCAGATGAAACAGGG + Intergenic
1097940047 12:65294175-65294197 GTTGGAAGCCATATGAAACAAGG - Intronic
1098084288 12:66825315-66825337 GTGTAAAGTCATATGGAGAAAGG - Intergenic
1098999797 12:77166128-77166150 GTTTTAAGTCATTTGAGAAATGG - Intergenic
1099428801 12:82555808-82555830 TTTCTAAGTCAAAGGGAACATGG - Intergenic
1101134066 12:101721377-101721399 CTTTAAAGTCATTTGGAGCAAGG + Intronic
1101300205 12:103471934-103471956 ATTTTAAGTCAAATGGGAAAAGG - Intronic
1102233275 12:111278107-111278129 GTGTTATGTTACATGGAACAGGG - Intronic
1102567700 12:113807785-113807807 GTATTAATTCATTTGGTACAAGG + Intergenic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1106324773 13:28677796-28677818 GTTTTAATTAACATGGAACCTGG + Intronic
1106460028 13:29960511-29960533 GGTGTGAGCCATATGGAACAGGG - Intergenic
1108675873 13:52737292-52737314 TACTTAAGTCATATGGATCAGGG + Intronic
1108909695 13:55530800-55530822 CCTTGAAGTCATATGTAACAGGG - Intergenic
1110388233 13:74939884-74939906 TTTTTAATTCATAAGAAACAAGG - Intergenic
1110757078 13:79187964-79187986 GTTTTGAGCCAAATAGAACATGG - Intergenic
1111292689 13:86188407-86188429 CCTTTAAGTGATATGGAAAAGGG + Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115828076 14:37299926-37299948 GTTTTGAGGCATATTGATCAAGG + Intronic
1116592644 14:46798871-46798893 TTTTTAGGTCATATGGCTCAGGG + Intergenic
1117020341 14:51564085-51564107 GTGTGAAGTAATATTGAACAAGG - Intronic
1119549666 14:75499320-75499342 TTTTTAAGTCAACTGGAACCTGG + Intergenic
1124857279 15:33401629-33401651 GTGTGATGTCATATGGAAAAAGG + Intronic
1126317290 15:47383630-47383652 GTTTTAACTCATAAGGCATAAGG + Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127536620 15:59895766-59895788 ATTTTAACTCTTCTGGAACAGGG - Intergenic
1129619310 15:77129293-77129315 TGTTTAAGTCATATAGAATATGG + Intronic
1129851284 15:78795343-78795365 CTTTTATTCCATATGGAACAGGG + Intronic
1131424582 15:92335122-92335144 CTTTTCAGGTATATGGAACAGGG + Intergenic
1139168892 16:64606112-64606134 GTTTGTAGGGATATGGAACATGG - Intergenic
1139721777 16:68861898-68861920 CTTTTAATTCATTTGGAACTTGG - Intronic
1146018828 17:29257000-29257022 CTTTTTTGTCATATGGAACTTGG - Exonic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146931798 17:36783009-36783031 GTATCAAGTCAGAAGGAACAAGG - Intergenic
1150450726 17:65265405-65265427 CTTTTAAGTTGTGTGGAACAAGG + Intergenic
1150816014 17:68392344-68392366 TTTTTAAGTCATATGGTGCAAGG - Intronic
1155594715 18:27472243-27472265 GTTCTAATTCATGTGGATCATGG + Intergenic
1156000245 18:32377281-32377303 GCTTTAAGCCATAAGGAAGAAGG + Intronic
1156516397 18:37684160-37684182 TCTTTAAGTCAGCTGGAACAAGG + Intergenic
1156782237 18:40864455-40864477 GTTTTGAATCATAACGAACAGGG - Intergenic
1158431396 18:57390363-57390385 GTTCTAAGTCATCTGGAACTGGG - Intergenic
1159738660 18:72136358-72136380 TTTGACAGTCATATGGAACAGGG - Intergenic
1162856609 19:13473507-13473529 GTTTTAAGCCATATAGTTCATGG + Intronic
926676240 2:15623818-15623840 GTTTTATATTATATGGAAGAAGG + Intronic
933035786 2:77395786-77395808 GTTTTAAATAATTTGAAACAAGG - Intronic
939672683 2:145032976-145032998 GTTGGAATTCATATGGAACAGGG + Intergenic
941611725 2:167669382-167669404 GTTTCAAGTTATATTGAATATGG + Intergenic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
942352442 2:175066219-175066241 GTTCTGAGCCATATGGAACTGGG - Intergenic
944840581 2:203620156-203620178 GTGTTGAGTAATATGCAACATGG - Intergenic
947049063 2:226021729-226021751 GTATTAAGTCATATGAGTCAGGG - Intergenic
947114945 2:226759707-226759729 GTTTTAAGTTATATCAAAAAAGG - Intronic
947410838 2:229837708-229837730 GATTTAGGTAATCTGGAACACGG - Intronic
947677595 2:231997453-231997475 GTTTTGGCTCATATGAAACAGGG + Intronic
948015517 2:234687484-234687506 ATTTTAAGTCTTATGTAAAAAGG - Intergenic
1169560273 20:6792498-6792520 TATTTAAGGCATATGAAACAAGG + Intergenic
1170850720 20:20002000-20002022 GTTTTAATTTGTATGGAAAAGGG - Exonic
1175085009 20:56451097-56451119 GTTTTACCTCAAATGCAACAAGG - Intronic
1175500044 20:59443407-59443429 GTTTCAAGTCAAATTGAAAAGGG - Intergenic
1176938989 21:14900879-14900901 TTTTTAAGTCATAAGGAAGAAGG - Intergenic
1177865793 21:26512144-26512166 GTTGTAAGACACATGGACCATGG - Intronic
1178300977 21:31452688-31452710 CTTTTGAGTCTTATGGAAAATGG - Intronic
1179295857 21:40061727-40061749 GATATTAGTGATATGGAACATGG + Intronic
1179717078 21:43294077-43294099 ATTTTCAGTCTTATGGTACAGGG + Intergenic
1182172947 22:28251845-28251867 GTTTTTAATCACATGGAATATGG - Intronic
949703365 3:6785589-6785611 CTTTTTAGTCATAAGAAACATGG - Intronic
949967567 3:9371407-9371429 GTTTAGAGTCACATGCAACAGGG + Exonic
952353687 3:32565150-32565172 GTTTTAAGGCATATTGAAATTGG - Intronic
952383600 3:32822536-32822558 ATTTTAAGTCATATTGTAAATGG + Intronic
954750107 3:52808719-52808741 ATTTTATGGCATCTGGAACATGG + Exonic
955712065 3:61790453-61790475 GTTTTCAGTAAAATAGAACATGG - Intronic
955931629 3:64063389-64063411 GTTTTAAAAAATATGCAACATGG - Intergenic
956757429 3:72402748-72402770 GTTTTAAGACAAATTAAACAGGG - Intronic
957591603 3:82206194-82206216 GTTTGATATTATATGGAACATGG - Intergenic
958616294 3:96496955-96496977 GAAGTAAGTCATATGAAACAAGG - Intergenic
960292959 3:115908732-115908754 GTTTTAAGTCATCTTAGACATGG + Intronic
960464075 3:117973994-117974016 GTTTTAAATTATATGGAAGGAGG + Intergenic
962659109 3:137582954-137582976 GTTTTAAATCATATAGCTCATGG + Intergenic
962726179 3:138229601-138229623 GTTTCCAGTAATAGGGAACAAGG - Intronic
962732890 3:138299567-138299589 GTTTCATGGCATAAGGAACAGGG - Intronic
963573077 3:147022139-147022161 GTTTCAATTCATATGGTATATGG + Intergenic
965157173 3:165077071-165077093 GTTGTAAAACATATGGAAGAAGG - Intronic
965834274 3:172834189-172834211 TTTTCAAGTCATATGGCAAAGGG + Intergenic
966945341 3:184773733-184773755 CTCTTCAGGCATATGGAACAGGG + Intergenic
969845089 4:9914192-9914214 GTGCTAAGTCCTATGGAGCAGGG + Intronic
969949431 4:10819190-10819212 GTTTCAAGTCACAAAGAACAGGG + Intergenic
970712389 4:18878403-18878425 GATTTTAGTAATGTGGAACATGG + Intergenic
976504790 4:85834265-85834287 GTGTTAGGTCCTATGGAAGAAGG - Intronic
980844687 4:138310180-138310202 GTTTTAAGTTATATTGTACTAGG - Intergenic
982457307 4:155625585-155625607 GATTTAAGTCAGATGGCAGAGGG + Intergenic
982870332 4:160571739-160571761 GTTTTAAGTCAATCAGAACATGG + Intergenic
983880926 4:172931656-172931678 GTAATAAGTCAGATGGAAAAAGG + Intronic
984316989 4:178140970-178140992 GTTGTGAGTTATATGGAATATGG - Intergenic
985237291 4:187890000-187890022 TTTTTAAGACGTATGCAACACGG - Intergenic
985356839 4:189129567-189129589 GTTTCAAGTCATTTGGAAGCTGG - Intergenic
986103543 5:4637269-4637291 GTTTTGAGTCAAAGGGAACAAGG + Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
987415016 5:17653713-17653735 GTCTTCTGTCATAGGGAACATGG + Intergenic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
990637871 5:57749890-57749912 GTTGTAAGACAGATGAAACAAGG - Intergenic
992904684 5:81334590-81334612 GTATTAAATCATATGTTACATGG + Intronic
994003262 5:94806369-94806391 CTTTTCAGTCATATGAAACAAGG + Intronic
996229077 5:121039126-121039148 TTTTGAAGTCCTATGGAAAAGGG - Intergenic
998126655 5:139627997-139628019 GTTTTATGTCCTATGTACCAAGG - Exonic
1000960314 5:167593447-167593469 GTTTTATTTTACATGGAACAAGG - Intronic
1001351623 5:170973153-170973175 GTTTTTAGTTAAAGGGAACATGG + Intronic
1002574367 5:180163710-180163732 ATTTTTGTTCATATGGAACATGG + Intronic
1003807931 6:9747256-9747278 TTTTAAATTCATCTGGAACAAGG + Intronic
1008362658 6:50639833-50639855 ATTTTAATTTATATGTAACAAGG - Intergenic
1008721240 6:54356125-54356147 TTTTAAGGTTATATGGAACAAGG + Intronic
1009845454 6:69128814-69128836 TTTTAAAGTTATAAGGAACATGG - Intronic
1010808200 6:80264114-80264136 ATTTTAAGTGATAAGTAACAAGG - Intronic
1015408186 6:132861230-132861252 ATATTAAGTCATATGTAATAGGG + Intergenic
1016202350 6:141428240-141428262 GGATTAAGTGATATGGAAAATGG + Intergenic
1016676239 6:146772090-146772112 GTTTTCTGTCATATGGATCTGGG - Intronic
1017450433 6:154549751-154549773 CTTTTGAGTCTTATGGAAAATGG - Intergenic
1021468969 7:20979806-20979828 GTTTTAATTCATTTGTAATATGG + Intergenic
1022204581 7:28150966-28150988 GTTTTAAGTTATAAGGCAAATGG + Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1026702928 7:72663434-72663456 GTTTTAGGTCACATAGATCATGG - Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1027450431 7:78325386-78325408 CTCTTAAGTCATAAGGAATAAGG - Intronic
1032658904 7:133961640-133961662 GTTTTAAGCCATAAGGTACATGG + Intronic
1033949624 7:146768219-146768241 AGTTTTAGTCATAAGGAACAAGG - Intronic
1036505365 8:9349971-9349993 GTTTTTATTCCCATGGAACAAGG - Intergenic
1039268950 8:35859656-35859678 ATTCCAAGTCATATGGAAGATGG - Intergenic
1039788513 8:40855341-40855363 GTTTTGAGTCATTTGGCACTAGG - Intronic
1042244568 8:66697671-66697693 GTGTTAAGACATAAGGTACAAGG - Intronic
1042903839 8:73753529-73753551 CTTTTAAGTCTTATGGCACATGG + Intronic
1043059669 8:75484289-75484311 GTTTTCAGTAAAATGGAAAATGG + Intronic
1043097082 8:75988871-75988893 CTTTTAAGCCATATTGAACTAGG + Intergenic
1043777224 8:84285506-84285528 GTTATAAATGCTATGGAACATGG + Intronic
1044092305 8:88016893-88016915 CTTATAGGTCACATGGAACACGG - Intergenic
1046164539 8:110414703-110414725 GTTATAAGTCATTCGGAGCAAGG - Intergenic
1046277359 8:111981547-111981569 ATTGCAAGTCATATGGCACAAGG - Intergenic
1049870140 8:144968510-144968532 CTTTTAGGTCATGTGGAATAAGG + Intergenic
1050685643 9:8165546-8165568 GCTTGAAGTTATAAGGAACAGGG - Intergenic
1051846274 9:21454974-21454996 CTTTTAGGTCATATAGAACAAGG + Intergenic
1052207441 9:25860056-25860078 GTTTTATGTCCTATGCACCAAGG - Intergenic
1056083865 9:83125423-83125445 GTTTTAAGCCATTCGGAATATGG + Intergenic
1058573580 9:106375112-106375134 GTGTTAAGTCACATGGCAAAAGG - Intergenic
1062059143 9:134485597-134485619 GTTTTAAGCCATATGAGCCACGG - Intergenic
1188461891 X:30436948-30436970 GTTTCAAGTTATATGGAGGATGG - Intergenic
1189886875 X:45555676-45555698 GTCTTAAGTAATATGGAAGTTGG + Intergenic
1192911408 X:75608434-75608456 GTTGTAAGTTATGTGGAATATGG + Intergenic
1192994067 X:76493332-76493354 GTTAGGAGTCATATGGGACAGGG - Intergenic
1195961408 X:110390941-110390963 ATTTTTTGTCATCTGGAACATGG + Intronic
1196766790 X:119253288-119253310 GTGTTAAGTAATATGTACCAAGG - Intergenic