ID: 1027011140

View in Genome Browser
Species Human (GRCh38)
Location 7:74745829-74745851
Sequence CTGTGAGGCCACCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027011137_1027011140 5 Left 1027011137 7:74745801-74745823 CCTGATCACATCACGACCGTTTT 0: 3
1: 0
2: 0
3: 5
4: 27
Right 1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG No data
1027011135_1027011140 21 Left 1027011135 7:74745785-74745807 CCTTTAGAAAAAAAACCCTGATC 0: 2
1: 0
2: 2
3: 27
4: 320
Right 1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG No data
1027011136_1027011140 6 Left 1027011136 7:74745800-74745822 CCCTGATCACATCACGACCGTTT 0: 3
1: 0
2: 0
3: 5
4: 73
Right 1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027011140 Original CRISPR CTGTGAGGCCACCACTGTGC TGG Intronic
No off target data available for this crispr