ID: 1027012435

View in Genome Browser
Species Human (GRCh38)
Location 7:74757647-74757669
Sequence GGGAGTAAACAGAAGGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 3, 1: 0, 2: 1, 3: 35, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027012435 Original CRISPR GGGAGTAAACAGAAGGATAA GGG Intronic
901228207 1:7626841-7626863 AGGAGTAAACAGAAGGGTTTAGG + Intronic
902686369 1:18080229-18080251 AGGAATAAAGAGGAGGATAAGGG + Intergenic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
903177384 1:21589151-21589173 GGGAGGAAATAGAAAGATGAGGG + Intergenic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
903730147 1:25487645-25487667 TGGAGTAAACAGAAAAATAAGGG - Intronic
903877183 1:26483169-26483191 GGGACTACACAGGAGGATGATGG - Intergenic
904843231 1:33387811-33387833 GCTAGTAAACAGAAGGCTATGGG - Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905829485 1:41053745-41053767 GGGAGCAGAAAGAAGCATAAAGG + Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
909502339 1:76349043-76349065 GGGAGAAAACAGAAGCAGCATGG - Intronic
910729574 1:90379583-90379605 GGGATAAAGCAGAAGGAAAAAGG - Intergenic
911105903 1:94131308-94131330 TGGAGAAAACAGAAGGAAAATGG + Intergenic
912306206 1:108570223-108570245 AGGAGAAAACAGAATGATAAAGG + Intronic
912443728 1:109717517-109717539 GAGAGTAGAAAGAAGGAAAAAGG - Exonic
912734469 1:112138013-112138035 GGAAGTATATAGAAAGATAAGGG - Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
915015998 1:152734454-152734476 GGGAGGAAGAAGCAGGATAACGG - Intergenic
915506186 1:156357785-156357807 TGGAGGAATCAGAAGGAGAAGGG + Intronic
916838221 1:168571789-168571811 GGAAGAAGACAGAAGCATAAGGG - Intergenic
917642563 1:176997193-176997215 AGGAGTAAACAAAAGAATTATGG - Intronic
918753791 1:188309539-188309561 GGAAGAAAACAGAAAGCTAAAGG + Intergenic
920868491 1:209773226-209773248 GGGTGCAAAGAGAAGGATACTGG - Intronic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
922350741 1:224733003-224733025 GGGAGTAAAAAGGGGGATAAAGG - Intronic
922412198 1:225387778-225387800 GACAGTAAACAAAAGGAGAAAGG + Intronic
922783106 1:228268976-228268998 GGGAGTGAACGGAAGGGTCAGGG + Intronic
924768904 1:247061888-247061910 GGGATTAAACAAAATGATAAGGG + Intronic
1062915746 10:1240344-1240366 GGGAGTAAACACCAGGACACAGG - Intronic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063461903 10:6220417-6220439 GGGAGAAAAAAGAAAGAAAATGG - Intronic
1063537239 10:6895873-6895895 GGGAGTAAACAGTGGGGAAATGG - Intergenic
1063597835 10:7453193-7453215 GGGATTTAACAGAAGAATAAGGG - Intergenic
1065400299 10:25292567-25292589 GGGAGTAAACAGTTGGAGAATGG + Intronic
1066192540 10:33069209-33069231 GGAAGGAAAAAGAAGGAGAAAGG - Intergenic
1067071475 10:43135747-43135769 GGAAGAGATCAGAAGGATAAGGG + Intergenic
1067131094 10:43566152-43566174 GGGAGTAAAGAGAATGCTACAGG - Intronic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1069658478 10:70107642-70107664 GGGAGTAAACAGTAAAACAAAGG + Intronic
1070145698 10:73772162-73772184 GGGAGTAAAGATGAGGCTAATGG - Intergenic
1070170393 10:73928476-73928498 GGGAGCAGACAGAAGGGCAATGG + Intergenic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1073782826 10:106858078-106858100 GGGATTAAACAGTAGGTTAAGGG + Intronic
1074769269 10:116722964-116722986 GGGAGTAAACAGCAGGCCAAAGG + Intronic
1075380288 10:122013241-122013263 GGAAGAAAACAGCAGGCTAAGGG + Intronic
1077921032 11:6641736-6641758 GGGAGAAAACAGAAGGAAACGGG + Intronic
1078178273 11:8987320-8987342 GGGAGTTAACAGAAAGCCAAAGG + Intronic
1080656776 11:34264581-34264603 GGGAGAAAACTGAAAGAAAAAGG - Intronic
1081346328 11:41991549-41991571 TGGAGTTACCAGAAGGATATGGG - Intergenic
1081722488 11:45300591-45300613 AGCAGTGAACAGAAGAATAATGG - Intergenic
1081789705 11:45774282-45774304 GGGAGTAAACAGGAGCCTAGGGG + Intergenic
1082199644 11:49349792-49349814 GGGAAAAAAAAGAAGGACAAAGG - Intergenic
1082705664 11:56491601-56491623 GGGAGTGAAAAGAAAGAAAATGG - Intergenic
1083591948 11:63900754-63900776 GGGAGCACAGAGAAGGAAAAGGG - Intronic
1084134459 11:67166076-67166098 GGCAGTAAACAGAAGTATTCAGG + Intronic
1084666024 11:70576808-70576830 GGGAGAAAAGTGAGGGATAAGGG - Intronic
1085072929 11:73564433-73564455 GGTAGTAAAAAGAAGGCTAGAGG + Intronic
1086597928 11:88596251-88596273 GGGAAGAAACAGAATGAAAAGGG - Intronic
1087177954 11:95112242-95112264 GTGAGAGAACAGGAGGATAAAGG - Intronic
1087652522 11:100884694-100884716 GGGAGTAGACAGCAGGGTAGTGG - Intronic
1087905232 11:103688252-103688274 GGGAGTAAGCAAAAGAAGAATGG + Intergenic
1088988022 11:114927129-114927151 GGGAGGAAATAGAAGGAGAAGGG + Intergenic
1089184023 11:116602714-116602736 GGGGGTTATCAGGAGGATAAGGG + Intergenic
1089644544 11:119869982-119870004 GGGCAGTAACAGAAGGATAAGGG - Intergenic
1089644671 11:119870898-119870920 AGGAGAATAAAGAAGGATAAGGG + Intergenic
1090785943 11:130047447-130047469 TGGAGAAAACAAAATGATAAAGG + Intergenic
1090861236 11:130654415-130654437 GGAAGTAAGCATGAGGATAATGG - Intergenic
1091112345 11:132981456-132981478 GGGAGAACACTGAGGGATAACGG + Intronic
1091176869 11:133566786-133566808 GGGAGTTAACACAATGTTAATGG - Intergenic
1092776269 12:11947364-11947386 GGGAGGAAACAGAAGGAACCAGG + Intergenic
1092951804 12:13510556-13510578 GTGAGGAAAGAGAAGGATCAGGG + Intergenic
1092994480 12:13935585-13935607 GCGAGGAAACAGATGCATAAGGG - Intronic
1093577105 12:20744980-20745002 GTAAGTAAAAAGAAGGAAAATGG + Intronic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094707974 12:32933129-32933151 GGGAGTAAAGACAAAGAAAAAGG + Intergenic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1096454519 12:51774056-51774078 GGGAGTAAAGCGAAGGAGACAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097309978 12:58108548-58108570 TGGAGTCAAGAGAAGGAGAAAGG - Intergenic
1098834388 12:75403745-75403767 TGGTGTGAACAGAAGGATGAAGG - Intronic
1099170345 12:79356311-79356333 GGGTGTAAACAAATGGCTAATGG - Intronic
1100166013 12:91918598-91918620 GGCAGAGAACAGAAGGATTATGG - Intergenic
1100219188 12:92485553-92485575 GGAAATGAACAGAAGGATGATGG + Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1100921508 12:99493568-99493590 TGGAATAAACAGTAGGATGAGGG - Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1103423773 12:120813090-120813112 GAGGGTAAATATAAGGATAAGGG + Intronic
1103502498 12:121414050-121414072 GGAATGCAACAGAAGGATAATGG - Intronic
1103821818 12:123704919-123704941 GGGAGTACAAAGATGAATAAAGG + Intronic
1104515887 12:129426278-129426300 GGAAGAAAACAGCAGGAGAAAGG + Intronic
1105259510 13:18768613-18768635 GGAAGAAGACAGAAAGATAAGGG - Intergenic
1105262188 13:18787929-18787951 GGAAGAAGACAGAAAGATAAGGG - Intergenic
1106012291 13:25836505-25836527 GGGAGGACGCAGAAGGAGAAGGG - Intronic
1106142808 13:27025434-27025456 GGGAGGATACAGCAGGATCAAGG - Intergenic
1106282336 13:28286690-28286712 GGGTATAAACACAAGGACAAAGG - Intronic
1106342332 13:28842229-28842251 TGGAGGAAGCAGAAGGAAAAAGG + Intronic
1106457610 13:29940844-29940866 AGGATTAAACAGAAGAAAAATGG + Intergenic
1106782217 13:33070389-33070411 GGGAGGAAAGCGAAGGATAGAGG + Intergenic
1107293402 13:38883124-38883146 GGGAATAAAGGGAAGGAAAAAGG - Exonic
1108304040 13:49113101-49113123 AGGAGAAAACAGAAGGGTAAGGG - Intronic
1112151577 13:96770582-96770604 GAGAGGAAATAGAAGGATATTGG + Intronic
1112273266 13:97990682-97990704 GGCAGTAAACATAAGCTTAATGG - Intronic
1114341197 14:21746398-21746420 GGAAGTAAACAGAATGATGAAGG + Intergenic
1114472787 14:22975162-22975184 GGGAGTAATAAGGAGCATAATGG - Intronic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1116113874 14:40623259-40623281 AGGAGTAAACTCAAGGAGAAAGG - Intergenic
1116682513 14:47991564-47991586 GGGGGGAAATAGAAGGAAAAGGG - Intergenic
1117494192 14:56285526-56285548 GGGAGAGAACAGAAAGAAAAGGG + Intronic
1117779725 14:59220162-59220184 GGCAGGAAATAGAATGATAAAGG + Intronic
1119093017 14:71801856-71801878 AGGAGTAAAAGGAAGGAGAAAGG + Intergenic
1119754470 14:77105299-77105321 GGGAGTGAAGAGAAGGGAAAAGG - Intronic
1120651676 14:87141171-87141193 GGGAGAAAAGGGAAGGATCAAGG + Intergenic
1120932579 14:89864411-89864433 GGAAGGAAACAAAAGGAAAAAGG - Intronic
1121186149 14:91971565-91971587 GGGAGAATAAAGAAGGAGAAGGG + Intronic
1121847849 14:97189566-97189588 GAGAGGAATCAGAAGGAAAAGGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122220360 14:100235048-100235070 GAGAGTAAGCAGAAGAATAAAGG - Intergenic
1123440888 15:20290616-20290638 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1123700593 15:22912108-22912130 GGGAGAAAACAAAAAGAGAAAGG + Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1124585661 15:31004130-31004152 GGGAGAAAATAAAAGAATAATGG - Intronic
1125878755 15:43173674-43173696 TGGAGAAAACAGTATGATAAAGG - Intronic
1125982088 15:44011668-44011690 AGGAGGAAAGAGAAGGGTAAAGG + Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128659866 15:69490976-69490998 CGGAGAAAACAAAAGAATAAGGG + Intergenic
1129076387 15:72999992-73000014 GGGAATAAAATGAAGGAGAAAGG - Intergenic
1129505453 15:76077913-76077935 GGGAGTAAACACATGGTAAATGG + Intronic
1131026437 15:89145904-89145926 AGGAGTACACAGAAGGACACTGG - Intronic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1133062571 16:3184111-3184133 GGGAAAAAAGAGAAGGAAAAGGG + Intergenic
1133063088 16:3188165-3188187 GGGAAAAAAGAGAAGGAAAAGGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1135294528 16:21267745-21267767 GGGAGTAACAAGAAGGATATTGG + Intronic
1135732107 16:24903531-24903553 GGAAGTAGACAGTAGGATAGTGG - Intronic
1136125807 16:28179549-28179571 TGGAGGAAACAGAAGCATCAAGG - Intronic
1136725966 16:32357771-32357793 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1136844298 16:33563820-33563842 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1137519854 16:49183375-49183397 GGGAGCAAACAGAGGGTGAATGG - Intergenic
1138091191 16:54176029-54176051 GGGAACAAAAAGAAAGATAAAGG - Intergenic
1138894810 16:61190751-61190773 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1138894817 16:61190781-61190803 GGGAAGAAAAAGAAGGAGAAGGG - Intergenic
1141270467 16:82535570-82535592 GGGATGAGACAGAAGGATATAGG - Intergenic
1141486983 16:84347060-84347082 GGGAGAGAACAGAAGGAGACTGG + Intergenic
1141555761 16:84835649-84835671 GGAAGACAACAGAAGGAAAAGGG - Intronic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1203000466 16_KI270728v1_random:159985-160007 GGGAGAAAACAGTGGGAAAAAGG - Intergenic
1203132067 16_KI270728v1_random:1696388-1696410 GGGAGAAAACAGTGGGAAAAAGG - Intergenic
1203154464 16_KI270728v1_random:1864119-1864141 GGGAGAAAACAGTGGGAAAAAGG + Intergenic
1142941083 17:3380210-3380232 GGGAGGAAGCAGAAGAATCATGG + Intergenic
1144439534 17:15268928-15268950 GGGAGGGAAGAGAAGGAGAAGGG + Intergenic
1145005781 17:19336973-19336995 GGGCGGACACAGAAGGGTAAAGG - Intergenic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1151146140 17:72043195-72043217 GTAAGGAAAGAGAAGGATAAAGG - Intergenic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154312336 18:13277024-13277046 GGCAGGAAACAGGAGGAGAAAGG + Intronic
1154429247 18:14295779-14295801 GGAAGAAGACAGAAAGATAAGGG + Intergenic
1155013565 18:21808163-21808185 TGGAGTTAGCAGAAGAATAAAGG + Intronic
1156043863 18:32856317-32856339 AGGAGAAAACTGAAGCATAAAGG + Intergenic
1156647814 18:39187692-39187714 GGGAGGAAACTGAAGCTTAAAGG - Intergenic
1157720842 18:49923067-49923089 GGGAGTAAGCAGTAGGAACAGGG + Intronic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159692048 18:71500506-71500528 GGGACGACACAGAAGGAAAAGGG - Intergenic
1162789822 19:13057049-13057071 GGGAGGGAACAGAATGAGAATGG + Intronic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1165286380 19:34846200-34846222 GGGAGAAAACAGAGGAATGATGG - Intergenic
1165733911 19:38163905-38163927 GGGAATAAACAGGGGGATGAGGG + Intronic
1166349890 19:42191674-42191696 GGCAGAAAACAGAGGGATCAAGG + Intronic
1168500408 19:56888247-56888269 GGGAGTATAGAGAAGGAAAGGGG - Intergenic
925781473 2:7386027-7386049 GGGGGAAGACAGAAAGATAAAGG + Intergenic
926824084 2:16884827-16884849 GAGAGTAAAAGGAAGAATAAAGG - Intergenic
927439096 2:23097680-23097702 GGGAGTAAAGAGAAGCATTGGGG - Intergenic
927784200 2:25961237-25961259 GGGAGTGAAGAGATGGAGAAAGG + Intronic
928341893 2:30450257-30450279 GGGAGCTAACTGGAGGATAAAGG + Intronic
929318776 2:40514360-40514382 GTGGGCAAACAGAAGGACAAAGG + Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932875459 2:75446691-75446713 GGGAGGAGGCAGAAGGATAGGGG - Intergenic
933596204 2:84285729-84285751 GGGAAAAGAAAGAAGGATAAAGG + Intergenic
934319918 2:91962804-91962826 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
934768022 2:96891481-96891503 GGGAGTTCAGAGAAGGACAAAGG + Intronic
934879635 2:97964616-97964638 GGGAGTAAACAGGTGGTTTAAGG - Intronic
936151989 2:110027085-110027107 GGGAGTACAGAGAGGGATCAGGG + Intergenic
936192689 2:110344328-110344350 GGGAGTACAGAGAGGGATCAGGG - Intergenic
936573887 2:113637650-113637672 GGTACTAAACAAGAGGATAATGG + Intronic
936758159 2:115739449-115739471 TGGAGTAATCAGAATGAGAACGG - Intronic
938313070 2:130307310-130307332 GGAAGAAAACAACAGGATAACGG - Intergenic
938654645 2:133418528-133418550 GTGAGAAAAGAGAAGGATCAGGG + Intronic
939462916 2:142519721-142519743 GGGAGTGAACTGAACGATAAAGG + Intergenic
940262504 2:151796313-151796335 GATAGTAAACAGAAGAAAAAAGG - Intronic
940649976 2:156432903-156432925 GGAAGGACACAGAAGGAAAAAGG - Intergenic
942225925 2:173815987-173816009 GGTAGTACAAAGAAGGAGAAGGG + Intergenic
944203356 2:197132095-197132117 GGGAGTACACAGAAAAAAAAAGG + Intronic
944679571 2:202064862-202064884 GTGAGTCAAGAGAAGGATTATGG + Intergenic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945259733 2:207832342-207832364 GGGAGGAAAAGGAAGGAGAAAGG + Intronic
945632746 2:212302958-212302980 GGGAGGAGAAAGAAGAATAAAGG + Intronic
945779153 2:214146342-214146364 GGGAGAAAGAAGAAGGATACAGG + Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
947229331 2:227869621-227869643 GGGAGGAAACAGAGGGCTGAAGG - Intergenic
947785514 2:232814974-232814996 GGAAGTAAACAAACAGATAATGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948466532 2:238154560-238154582 GCAAGAAAACAGAAGGATACAGG + Intergenic
948554465 2:238797839-238797861 AGGAGTAAACAGATGGGTAGCGG - Intergenic
1169128639 20:3150252-3150274 GGGAGAAAGCAGAAGGTTGAGGG + Intronic
1170134902 20:13061984-13062006 GGGAGTGAAGAGGAGGAGAAGGG - Intronic
1170317473 20:15058201-15058223 GGGAGTCAAAAAAAGGTTAAAGG + Intronic
1172653342 20:36521261-36521283 GGGAGAAATCAGAGGGATCATGG - Intronic
1177453023 21:21296638-21296660 GGGAGTTGACACAAGGATATTGG + Intronic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1177777713 21:25587757-25587779 CGTAGTAAATAGAAGGAGAATGG + Exonic
1180308167 22:11146849-11146871 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1180546643 22:16508662-16508684 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1181760703 22:25056992-25057014 GGGAGTATGAAGACGGATAATGG - Intronic
1182212539 22:28688687-28688709 GGGAGGAAACAGTGGGAAAAAGG + Intronic
1182851481 22:33478303-33478325 GGAAGTACACTGAAGGCTAAAGG + Intronic
1183169540 22:36176475-36176497 TGGTATAAAAAGAAGGATAAGGG - Intergenic
1184310781 22:43640999-43641021 GGAAGTAAACAGAAGGGGTATGG - Intronic
949205989 3:1439680-1439702 GGGTCTACAAAGAAGGATAAAGG + Intergenic
950560118 3:13716319-13716341 GGGAGTACATACAAGGATAGAGG - Intergenic
951105990 3:18743688-18743710 GGGATTAAACAAAATTATAAGGG + Intergenic
951231800 3:20187658-20187680 GGCAGTAAACTGAGGGTTAATGG - Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
952223647 3:31351277-31351299 GTGAGAAAACTGAAGCATAAAGG - Intergenic
952420667 3:33128114-33128136 GGAAATAAACTGAAGTATAATGG - Intronic
953248479 3:41220207-41220229 GGTAGGAAACAGAAGGTAAATGG - Intronic
953319959 3:41962630-41962652 GGAAGGAAACAGAAGGACAGTGG - Intergenic
954168378 3:48779424-48779446 GGGAGTACACAGCAGGGCAAAGG + Intronic
954602004 3:51877578-51877600 GGGTGTTATGAGAAGGATAAAGG + Intergenic
956313467 3:67907748-67907770 GGGAGACAAGAGAAGGAAAAAGG - Intergenic
956472656 3:69584315-69584337 GGGAGGAAAGAGAAGGAGAAGGG - Intergenic
956531287 3:70222082-70222104 GGGAGAAACCTAAAGGATAAAGG - Intergenic
956624108 3:71249779-71249801 GGGAGAAGACAGAAGAATAAAGG + Intronic
956846523 3:73188768-73188790 GGGAGGAAAGAGAAGAAAAAAGG - Intergenic
957004340 3:74926906-74926928 GGAAGTTAAGAGAGGGATAAGGG - Intergenic
957663709 3:83195082-83195104 TGGAGTAAACAGAATAAAAAGGG + Intergenic
957985415 3:87568971-87568993 GGCAGCAGACAGAAGGAAAAAGG + Intergenic
959364665 3:105442204-105442226 GGGAGAAAAAAGAAGTATAAAGG - Intronic
959598391 3:108152299-108152321 GGGAGTTAACATGTGGATAATGG + Intergenic
959836958 3:110930103-110930125 AGGAGGAAACAAAAAGATAAAGG + Intergenic
960051535 3:113243283-113243305 GGGAGTAAAAACAATGATAATGG + Intronic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
961103308 3:124220453-124220475 GGGAGAAAACATAAGGTAAAGGG - Intronic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
962657655 3:137565096-137565118 GTCAGTAGACAGAAGGATAGAGG - Intergenic
963153508 3:142071732-142071754 GGGAGTAGACAGAAAGAGAAAGG + Intronic
965452067 3:168850337-168850359 GGGAGAGAGCAGAAAGATAAGGG + Intergenic
966145897 3:176811812-176811834 GGGAGTAAAGAGGAGGCTGAGGG + Intergenic
966330612 3:178808122-178808144 GGGAATAAGAAGAAAGATAAAGG + Intronic
967461812 3:189756715-189756737 GGGAGGAGACAGAAGGAAAAGGG - Intronic
967497757 3:190161250-190161272 TGGAGTTAACAGGAGGAAAAAGG - Intergenic
969172932 4:5378511-5378533 AGAAGAAAACAGAAAGATAAAGG - Intronic
973952942 4:56036033-56036055 TGGAGTAAACAGAAGACTGATGG - Intergenic
976571074 4:86611686-86611708 GGGAGAAACCAGATGGAGAATGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977375248 4:96194881-96194903 GTGAGTAGAAAGGAGGATAAAGG + Intergenic
977456390 4:97266377-97266399 GGGAGAAAGCAAAAGGAAAAAGG - Intronic
982304888 4:153920590-153920612 GGGAGGTGAGAGAAGGATAAGGG - Intergenic
982845970 4:160252942-160252964 AGGAGTAAACTGAAGTTTAAAGG - Intergenic
984010498 4:174365596-174365618 GAGAGGAAACAGAAAAATAAAGG - Intergenic
984121824 4:175754942-175754964 GGGAGTAGACAGAGGGAGAGAGG - Intronic
985905125 5:2828870-2828892 AGGATTAAACAGAATGAAAAAGG + Intergenic
986083846 5:4422758-4422780 GGAAGTCAACAAAAGGAGAATGG - Intergenic
986184242 5:5421920-5421942 GAGAGAAAACGGAAAGATAAAGG - Intronic
986793782 5:11189856-11189878 TGGAGTATACAGAAAGTTAAAGG + Intronic
986961116 5:13214144-13214166 TAGATAAAACAGAAGGATAAGGG - Intergenic
988252252 5:28774349-28774371 GACAGTATACAGTAGGATAAAGG - Intergenic
988787619 5:34579138-34579160 GGGAGGAAGGAGAAGGAGAAAGG + Intergenic
993874975 5:93295801-93295823 GGAAGTAAACAGGAAGAGAAAGG + Intergenic
993995053 5:94712774-94712796 TGGAGAGAACAGAAGGCTAAGGG + Intronic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
995866738 5:116699609-116699631 AGAAGTAAACAGAAAGAAAAAGG - Intergenic
996111534 5:119571622-119571644 AGGATTAAACAGAAGGTGAAGGG - Intronic
996489403 5:124075425-124075447 GGGACTAAACAGAATGATATCGG - Intergenic
996551251 5:124732783-124732805 GGGAGTAAAAAGTAGAAGAAAGG - Intronic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
1000365696 5:160488795-160488817 GGGAGTAATAATAATGATAATGG + Intergenic
1001276514 5:170355264-170355286 TGGGGTAAACAGGAGGTTAATGG + Intronic
1003954448 6:11148737-11148759 GGGAGAAAAAAGAACGAGAAAGG - Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004299863 6:14447521-14447543 GGGAGAAATCAGAAGGAAAAGGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1005123741 6:22421148-22421170 GGCATTAAACAGAAGGATCGTGG - Intergenic
1006683581 6:35814432-35814454 GGCTGTTAACAGAAGGAGAAGGG + Intronic
1006997764 6:38278111-38278133 GGCAGGAAAAAGAAGGACAAAGG - Intronic
1008127346 6:47683921-47683943 GGGAGACAAGAGAAGGAAAATGG - Intronic
1008259386 6:49346277-49346299 AGGAGACAGCAGAAGGATAAAGG + Intergenic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1010166569 6:72921504-72921526 GGGAGTAGACAGGAGTATCAGGG + Intronic
1011782545 6:90806237-90806259 AGGAGGTAAAAGAAGGATAAAGG - Intergenic
1012879349 6:104766935-104766957 GTGAGGAAACAGAAGCATATAGG - Intronic
1013838260 6:114358805-114358827 GGGAGAAAATAGAAGGTTATGGG + Intergenic
1014007964 6:116442934-116442956 GGGAGTAAACATATGGAATATGG - Intergenic
1014787806 6:125638264-125638286 TGGAGTATACAGTTGGATAAGGG - Intergenic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015695070 6:135970884-135970906 GGTAGTAAACAGAAGAAAAGAGG + Intronic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1017433322 6:154392520-154392542 GGCACTAAACAGATGGCTAAAGG + Exonic
1018641949 6:165911917-165911939 GGTAGTGAACAGAAGGTGAAGGG - Intronic
1019089812 6:169519172-169519194 AGAAGAAAACAGAAAGATAAGGG - Intronic
1021408145 7:20297994-20298016 TGGAGCAAACAGTAGGACAATGG - Intergenic
1022918774 7:34990998-34991020 GGGAGTATCCAGAAGGAGACAGG + Intronic
1022990420 7:35701808-35701830 AGTAGTATACAGAAGGAAAAAGG - Intergenic
1023287589 7:38634925-38634947 GGGAGTAAACAGTGGCCTAATGG - Intergenic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024810979 7:53212042-53212064 GGGAGAAATCAGTAGGAGAAGGG - Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1026794464 7:73357692-73357714 GGGAGGAAAGAGAAGGGAAAGGG + Intronic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1027787454 7:82598350-82598372 GGAAGGAAACAGCAGGCTAAAGG - Intergenic
1028055824 7:86241322-86241344 GAGAGAAAAAAGAAGGAGAAGGG + Intergenic
1028870008 7:95760015-95760037 GGAAGGAAACATAAGGATGAGGG + Intergenic
1029013554 7:97289522-97289544 GGGAGTACACAAAAGGAAAATGG - Intergenic
1030099017 7:105928480-105928502 GGGAGTTATCAGTTGGATAATGG + Intronic
1031160412 7:118160790-118160812 GGGAGAGAACAAAAGTATAAAGG + Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1033075637 7:138247693-138247715 GCGACTAAACAGCAGGACAAAGG + Intergenic
1035115646 7:156521051-156521073 GGGATGAGACAGGAGGATAAGGG + Intergenic
1035531924 8:359464-359486 AAGATTAAACACAAGGATAACGG - Intergenic
1036114045 8:5939032-5939054 GTGAGTAAACAGAAAAACAAAGG + Intergenic
1038510376 8:28128631-28128653 GGGAGTAAACAGCATGTTCAAGG - Intronic
1039904615 8:41776988-41777010 AGGATTAAACAGAAAGAAAATGG - Intronic
1040582922 8:48712185-48712207 GGAAGTAAGCAGAAGGATTTAGG - Intronic
1040938612 8:52809121-52809143 GGGAGAAAACATAAGGGAAAGGG - Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042462222 8:69082901-69082923 GGGAGTAATGACAAGGAAAAAGG + Intergenic
1042966806 8:74362357-74362379 AGGAATCAACAGAAGGAGAAAGG - Intronic
1043309625 8:78842358-78842380 GGGAATAACCAGAGGGTTAAAGG + Intergenic
1043428968 8:80175931-80175953 GGTAGTAAACAAAGGGATGAAGG + Intronic
1044389494 8:91632885-91632907 GGTAGTAAACAGAAGAGTGATGG + Intergenic
1044502730 8:92978295-92978317 GGGAGTAAACAAATGCATAAGGG - Intronic
1045235406 8:100348258-100348280 GGGAGTAAGCAGATGGGAAATGG - Intronic
1045697892 8:104831275-104831297 ACGAGGAAACAGAAGGAAAAGGG + Intronic
1046357930 8:113112010-113112032 GGGAGTAAGAAGAAGAAGAAGGG - Intronic
1048319323 8:133386118-133386140 GGTAGTAAATAAAAGGATGATGG - Intergenic
1048388182 8:133933293-133933315 AAGAGTAAACATCAGGATAAAGG + Intergenic
1050132467 9:2426991-2427013 GGGTGTAATGAGAAGGATGACGG + Intergenic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1052483398 9:29062670-29062692 GGGAGTAAAGAGAATGAAATGGG + Intergenic
1052594256 9:30537872-30537894 GGGAGGAAAAAGAAGTTTAATGG - Intergenic
1052885099 9:33638634-33638656 GGAATTTAACACAAGGATAAAGG + Intergenic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055699024 9:78920979-78921001 GAGAGAAATCAGAAGGACAAAGG - Intergenic
1055721872 9:79183602-79183624 AGTAGTAAACAGAAAGAAAAGGG + Intergenic
1056692560 9:88820290-88820312 GGGACTTTGCAGAAGGATAAGGG - Intergenic
1057094270 9:92291574-92291596 GGTATTAAACAGAAGGTTTAAGG + Intronic
1057231116 9:93322027-93322049 GGTAGTAAACAGTAGTACAATGG + Intronic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1057919287 9:99083262-99083284 GGGAGGAGACAGAAAAATAAGGG + Intergenic
1058513279 9:105742419-105742441 GGGAGAAAAGAGGAGGAAAAAGG - Intronic
1059728008 9:117028202-117028224 GTGAATAAACAGAAGGTTCAAGG + Intronic
1059933861 9:119288167-119288189 GGGAGAAAAAAGAAGGACAATGG - Intronic
1060362250 9:122970592-122970614 GGAAGGAGACAGAGGGATAAGGG - Intronic
1060423809 9:123488176-123488198 TGGAGTAAACACATGGACAATGG + Intronic
1061321073 9:129829958-129829980 AGAAGAAAACAGAAGAATAAAGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1186265162 X:7824687-7824709 GCAAGTCAACAGAAGGAAAAAGG - Intergenic
1186499558 X:10040471-10040493 GTGAGTAAAAAGTATGATAAAGG + Intronic
1186696365 X:12037394-12037416 GGAAGTAAAGATAAGTATAAAGG - Intergenic
1187032804 X:15505219-15505241 AGAAGTAAATAGAAGGAGAAAGG + Intronic
1187706192 X:22011877-22011899 GGTTCTAAACACAAGGATAAGGG + Intergenic
1188248128 X:27858229-27858251 AGGAGTAAACAGAAAGACAAGGG - Intergenic
1188555639 X:31409224-31409246 GGGAGTAAACGCAAAGAAAATGG - Intronic
1190989261 X:55528531-55528553 GGGAGTAGACTGAAGGAGTAGGG + Intergenic
1193020651 X:76789010-76789032 GTGAGTAAACAGGAGGGCAACGG - Intergenic
1194433870 X:93846052-93846074 GGAAGAAAACGGAAGGACAAAGG - Intergenic
1196626770 X:117885809-117885831 GGAAGTAAAAAGAAAGATACTGG - Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1201187444 Y:11417900-11417922 GGGAGGAAACAGTGGGAAAAAGG - Intergenic
1202297023 Y:23369795-23369817 TAGAGTAGACAGTAGGATAAGGG + Intergenic
1202573784 Y:26300802-26300824 TAGAGTAGACAGTAGGATAAGGG - Intergenic