ID: 1027017394

View in Genome Browser
Species Human (GRCh38)
Location 7:74788067-74788089
Sequence AGCGGGGGGCGCCGCCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 3, 1: 0, 2: 1, 3: 21, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027017391_1027017394 -9 Left 1027017391 7:74788053-74788075 CCAACGCCAGATCAAGCGGGGGG 0: 3
1: 0
2: 0
3: 0
4: 27
Right 1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG 0: 3
1: 0
2: 1
3: 21
4: 237
1027017389_1027017394 -8 Left 1027017389 7:74788052-74788074 CCCAACGCCAGATCAAGCGGGGG 0: 3
1: 0
2: 0
3: 1
4: 35
Right 1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG 0: 3
1: 0
2: 1
3: 21
4: 237
1027017384_1027017394 -2 Left 1027017384 7:74788046-74788068 CCCAGGCCCAACGCCAGATCAAG 0: 3
1: 0
2: 1
3: 8
4: 164
Right 1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG 0: 3
1: 0
2: 1
3: 21
4: 237
1027017385_1027017394 -3 Left 1027017385 7:74788047-74788069 CCAGGCCCAACGCCAGATCAAGC 0: 3
1: 0
2: 1
3: 4
4: 102
Right 1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG 0: 3
1: 0
2: 1
3: 21
4: 237
1027017382_1027017394 24 Left 1027017382 7:74788020-74788042 CCTGCAAAAGTCAGGGCAAGACG 0: 2
1: 1
2: 0
3: 8
4: 98
Right 1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG 0: 3
1: 0
2: 1
3: 21
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027017394 Original CRISPR AGCGGGGGGCGCCGCCCCGC AGG Exonic
900382332 1:2391209-2391231 CGCGGGGGGCGACCCCCTGCAGG + Intronic
900458657 1:2789781-2789803 AGCAGGGGGCGCCGCACCCGGGG - Intronic
901433870 1:9234685-9234707 AGCGGAGGGCGTGGCCTCGCCGG + Intergenic
903132694 1:21290054-21290076 AGCGGAGGGCGCCTACCTGCAGG + Exonic
903324680 1:22563290-22563312 AGCGCGGGGCGCGCCCCCGAAGG + Intergenic
903792893 1:25906535-25906557 CGCGTGGAGCGCCGCCCCCCGGG + Intronic
904822903 1:33256694-33256716 GGCGGCGGGCGCCTGCCCGCGGG + Intronic
904942883 1:34177303-34177325 CTCGGGGGGCGGGGCCCCGCAGG - Intronic
911853993 1:102854092-102854114 AGCAGGGGGCGGCGCCCATCGGG - Intergenic
915616872 1:157045875-157045897 AGCCTGCGGCCCCGCCCCGCGGG - Intergenic
916414116 1:164576713-164576735 AGAGAGGGCCGCCGCCCCCCAGG + Intronic
916667036 1:166975731-166975753 CGCGGGGGAGGCCGCCCCGCGGG + Intronic
917093944 1:171381728-171381750 AGCAGGGGGCGGCGCCTCTCCGG + Intergenic
918659715 1:187073860-187073882 AGCAGGGGGCGGCGCTCCTCAGG + Intergenic
918993933 1:191732087-191732109 AGCAGGGGGCGGCGCTCCTCAGG - Intergenic
919764026 1:201114923-201114945 AGCGGGGGGCGTCGAGCCGTCGG + Exonic
922855842 1:228774020-228774042 AGCAGGGGGCGCCGCTCATCGGG - Intergenic
923022714 1:230177297-230177319 AGCTGGGTTCCCCGCCCCGCAGG + Intronic
923650316 1:235867124-235867146 AGGGGGGCGGGCCGACCCGCGGG + Intronic
924117570 1:240762805-240762827 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
924527067 1:244863036-244863058 GGAGGGGAGCGCCGCCGCGCCGG - Intronic
924527075 1:244863059-244863081 CGCGGGGAGCGCGGGCCCGCGGG - Intronic
1064230874 10:13528765-13528787 ACCGGGAGGCGGCGCCGCGCGGG - Intronic
1066293666 10:34035703-34035725 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
1067980032 10:51074295-51074317 CGCGGTGGGCGCCGCGGCGCGGG - Exonic
1070564048 10:77590325-77590347 AGCAGGGGGCGGCGCTCCTCGGG + Intronic
1076657940 10:132036840-132036862 GGCGGGGGGCGACGTCCCGAGGG + Intergenic
1077085240 11:747008-747030 AGCGGCGGGGGACGCCCTGCGGG - Intergenic
1077228435 11:1448316-1448338 GGCGGGTGGCGCCGCCCCCAAGG + Intronic
1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG + Exonic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1080540263 11:33257902-33257924 AGCGAGGGGCGCCGCCACCCCGG + Intronic
1081873095 11:46392008-46392030 AGCAGGGGGCGCTGCCCTCCGGG + Intergenic
1083701940 11:64485281-64485303 AGATGGAGGCGCCGCCCCACTGG - Intergenic
1084575672 11:69986432-69986454 GGCTGGGGGCGCCGCCGGGCAGG + Intergenic
1084696446 11:70758428-70758450 AGCAATGGGCGCCGCCTCGCTGG - Intronic
1085205823 11:74731344-74731366 TGCTGGGACCGCCGCCCCGCCGG - Intronic
1088823327 11:113474780-113474802 AGCTGGGGCAGCCTCCCCGCGGG - Intronic
1089262398 11:117232141-117232163 CGCGGGGGTCGCCGGGCCGCAGG - Exonic
1089729521 11:120511673-120511695 GGCGCGGGGCGCCGCCCGGCGGG - Intergenic
1091233407 11:134002933-134002955 AGCGGGGGGCGGCGCTCGTCGGG + Intergenic
1091358357 11:134955497-134955519 AGTAGTGGGTGCCGCCCCGCCGG + Intergenic
1091616082 12:2052564-2052586 CGCGGGGGGCGCGACGCCGCCGG + Intronic
1093583209 12:20807438-20807460 AGCAGGGGGCGGCGCTCCTCGGG + Intergenic
1096495468 12:52037187-52037209 GGCGGGGGGCGCCGCGCGGCCGG + Intronic
1096870381 12:54588752-54588774 TGCGGGGGTCACCGCCCCGCGGG + Intergenic
1098275476 12:68808029-68808051 AGTGGGGGGTGTCGCCCCGCGGG - Intergenic
1099956260 12:89354239-89354261 AGCGGGGGCAGCCGTCCGGCGGG + Intergenic
1102924941 12:116819425-116819447 ATCGGCCGGCGCCGTCCCGCGGG + Intronic
1103362363 12:120361722-120361744 GGCGGGGGGCCCCCCGCCGCGGG + Intronic
1103410933 12:120710829-120710851 AGCGGGAAGCGCGGCCCGGCCGG - Intronic
1103760824 12:123249362-123249384 AGCAGGGGGCGGCGCCCGTCCGG + Intronic
1104692763 12:130839105-130839127 GGCGGGGCGCGCTGCCCGGCCGG - Exonic
1105639981 13:22252450-22252472 AGCGGGAGGCGCAGCCCAGAGGG - Intergenic
1109364683 13:61339485-61339507 AGCAGGGGGCGGCGCTCCACTGG - Intergenic
1112271814 13:97976221-97976243 AGCGGGAGGAGCCGGCCGGCGGG - Intronic
1112563310 13:100532513-100532535 AGCCGTGGGCGCCGTCCCGCAGG + Exonic
1113654206 13:112057938-112057960 AGCGGGCGGCTCCGCGGCGCTGG - Intergenic
1113900107 13:113792024-113792046 AGCTGGGGACGCGGCCCCGCTGG + Intronic
1115119872 14:29927185-29927207 CGCAGGGGGCGCTGCCCGGCTGG - Intronic
1115399462 14:32939974-32939996 AGCGGAGGGCGCAGCCCGGGAGG - Intronic
1116250990 14:42482437-42482459 AGCAGGGGGCGGCGCTCCTCGGG + Intergenic
1116437650 14:44912480-44912502 AGCAGGGGGCGGCGCCCGTCGGG - Intergenic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1119756800 14:77125382-77125404 GGCGGGGGGCGACGGCTCGCCGG - Intronic
1120953524 14:90062295-90062317 AGACGGCGGCGCCGCCCAGCAGG - Exonic
1122789089 14:104176855-104176877 GGCCGGGGGGGCCGCCCCACTGG - Exonic
1122917237 14:104864960-104864982 AGCGGGGGGCGCTGCCGAGACGG + Intergenic
1122975404 14:105168823-105168845 AGGGGGCGGGGCCGCGCCGCGGG + Exonic
1123392240 15:19888497-19888519 AGCGGGGTGCGCCTCCTCACAGG - Intergenic
1124500931 15:30225713-30225735 CGCGGAGGGGGCTGCCCCGCCGG - Intergenic
1124742639 15:32312954-32312976 CGCGGAGGGGGCTGCCCCGCCGG + Intergenic
1125464108 15:39934115-39934137 AGCGCGGAGCCCCGCCCCGCAGG + Intergenic
1125631634 15:41151955-41151977 AGCAGGGGGCGGCGCTCCTCCGG - Intergenic
1126165481 15:45651056-45651078 AGCAGGGGGCGGCGCCCATCAGG + Intronic
1126736630 15:51737574-51737596 CGCGGGGGCCGCCTTCCCGCAGG + Exonic
1127257842 15:57306789-57306811 AGCAGGGGGCGCCCCGGCGCTGG - Intergenic
1128456542 15:67834636-67834658 GGGGGTGGGAGCCGCCCCGCGGG + Intergenic
1129082519 15:73052809-73052831 AGCGGCGGGCGCGGGCCCGGGGG + Intronic
1129322269 15:74781998-74782020 GGCAGGGGGCGCCGCCCCGCCGG + Intergenic
1132522443 16:397737-397759 GGTGGGGGGAGCCGCTCCGCTGG + Intronic
1132588169 16:715185-715207 AGCCGGGGGCGCCGGCCGCCCGG - Exonic
1132612649 16:824937-824959 AGCAGGGGCAGCCCCCCCGCAGG - Intergenic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1134149694 16:11796583-11796605 AGGCGGGGGCGCCGCCCGGGAGG - Intronic
1135821785 16:25692112-25692134 AGGGGGGCGCGCGGACCCGCCGG - Exonic
1136247481 16:28984251-28984273 CGCGGGTGGAGCGGCCCCGCTGG - Exonic
1136590336 16:31214632-31214654 GGCCGGGCCCGCCGCCCCGCAGG - Intronic
1137787753 16:51151886-51151908 GGCGAGGCGCGCCGGCCCGCGGG + Intergenic
1138651537 16:58463967-58463989 AGGAGGGGGCGCCGCCCCCGCGG - Intronic
1139140900 16:64261187-64261209 GGCGGGGGGCGACGGACCGCGGG - Intergenic
1139418143 16:66830933-66830955 AGCTGGTGGCGGCGCTCCGCAGG - Exonic
1139664511 16:68447087-68447109 GGCGGGGGGCGCGGCCGCGGAGG - Intronic
1140927865 16:79600272-79600294 AGCGGGGGACGCCGCGCACCGGG - Exonic
1141830124 16:86505747-86505769 CGCGAGGGCAGCCGCCCCGCCGG - Intergenic
1142375015 16:89702105-89702127 TGCAGGTGGCCCCGCCCCGCAGG - Intergenic
1143140602 17:4739932-4739954 AGCGGGCGGCCACGCCCCCCGGG - Intergenic
1143495022 17:7307844-7307866 AGCGGCGGCCGCCGCCGCACGGG + Intronic
1144519594 17:15945075-15945097 CGCGGGGGGCCCCGACCCGTGGG + Exonic
1145007211 17:19344572-19344594 AGCCGCGGGCTTCGCCCCGCCGG + Intronic
1145050250 17:19654356-19654378 AGCAGGGGGCGGCGCCCATCAGG + Intronic
1145093902 17:20008818-20008840 AGCGGGGGGGCGGGCCCCGCAGG + Intergenic
1147684053 17:42276411-42276433 AGCGGCGCGCGCGCCCCCGCGGG - Intronic
1147997581 17:44369120-44369142 AGCAGGGGGCGCCGCTCATCCGG - Intergenic
1148664077 17:49361852-49361874 TGCCGGGGGCGCCGCCGCGGCGG + Intronic
1148838451 17:50478987-50479009 AGCGCCGCGCGCCGGCCCGCAGG - Exonic
1150786712 17:68169402-68169424 AGCAGGGGGCGGCGCTCCTCGGG + Intergenic
1150830318 17:68512687-68512709 CCCGGCGGGCGCCTCCCCGCAGG + Intronic
1152538338 17:80963012-80963034 AGCTGATGGCGCCGACCCGCTGG - Exonic
1152742037 17:82022666-82022688 CGCGGGGCGCGCGGCCCGGCCGG + Intronic
1153457190 18:5295185-5295207 AGCGGGGCGCGGCGCGGCGCGGG - Intronic
1153805372 18:8705524-8705546 AGCGCGGGGCGCAGCCCGGGCGG + Intergenic
1153900754 18:9614886-9614908 CGCGGGAGGCCCCGCCCGGCCGG - Intronic
1154496588 18:14965721-14965743 AGCAGTGGGTGCCGCCCCGCCGG - Intergenic
1160613876 18:80109499-80109521 GGCAGGGGGCGTCGCCGCGCGGG - Intronic
1160659645 19:291904-291926 AGCGGCGGGACCGGCCCCGCGGG + Intergenic
1160668519 19:344716-344738 GGCGGGGGGCGCGGACGCGCGGG + Intronic
1160703799 19:519809-519831 AGCGGAGGGGGACGCCCCACGGG + Intergenic
1160725594 19:616623-616645 CGCGGAGGGGGCTGCCCCGCCGG - Exonic
1160880821 19:1319177-1319199 GGCGGGGGGAGCCGCCCGGCCGG - Intergenic
1160912735 19:1482323-1482345 AGCAGTGGGCCCTGCCCCGCCGG + Intronic
1161097137 19:2398966-2398988 AGGGAGGGGCTCCGCCCTGCTGG - Intronic
1161124168 19:2546619-2546641 AGCGGCGGGACCTGCCCCGCTGG - Intronic
1161925066 19:7293924-7293946 AGCGCGCGGCGCTGGCCCGCGGG + Exonic
1162374430 19:10296370-10296392 GGCGGGGGGCGCGGCGCTGCTGG + Exonic
1163666695 19:18606871-18606893 TGCGGGGCCCGCCGCCCCCCCGG - Intronic
1164402138 19:27909846-27909868 AGCGGGAGGAGGCGGCCCGCGGG - Intergenic
1165445932 19:35856759-35856781 AGCTGGGGGCGCCCACCCGCCGG + Intronic
1166513787 19:43430194-43430216 ACCGGGGGGCACTGCCCCACAGG - Intergenic
1166783064 19:45352311-45352333 AGCGGGGGAAGCTGCCCCGCTGG - Exonic
1166979358 19:46623673-46623695 AGAAGGCGGCGCCGCCCGGCTGG + Exonic
1167040889 19:47021794-47021816 CGCTGGGGGCGCCGCCCTGGGGG + Exonic
1167743911 19:51340116-51340138 AGCAGGAGGCGCGACCCCGCGGG + Exonic
1167798128 19:51724099-51724121 AGCGGGTGGAGCTGCCCGGCTGG - Intergenic
927606662 2:24491813-24491835 AGCTGGGGGCTGCTCCCCGCCGG + Intergenic
929789853 2:45014268-45014290 AGCCGAGCGCGCAGCCCCGCCGG - Intergenic
935866480 2:107392602-107392624 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
936561301 2:113541845-113541867 GGCGCGGGGCGCCGACCTGCTGG + Intergenic
938343334 2:130549580-130549602 AGGGCGGGGCGCTCCCCCGCTGG - Intronic
938346499 2:130571142-130571164 AGGGCGGGGCGCTCCCCCGCTGG + Intronic
939465177 2:142546377-142546399 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
941934800 2:170974075-170974097 AGCAGGAGCCTCCGCCCCGCGGG - Intergenic
945451451 2:210000660-210000682 AGCAGGGGGCGGCGCTCCTCAGG + Intergenic
947860517 2:233354527-233354549 GGCGGCGGGCGCCCCTCCGCCGG + Exonic
948479257 2:238239966-238239988 AGCGGAGGGCGCCGGCACTCCGG - Exonic
948958558 2:241314985-241315007 CGCGGGCGGCTCCGGCCCGCGGG - Intronic
1172146937 20:32763422-32763444 ACAGGGAGGCGCCGCCCCTCCGG - Intronic
1172876124 20:38165315-38165337 GGCCGGGGGCGGGGCCCCGCGGG + Exonic
1175254195 20:57629105-57629127 AGCAGGGGGCGGCGCTCGGCAGG - Intergenic
1175847401 20:62065899-62065921 GGCGGGGGGCGGCGCGCGGCCGG + Intergenic
1175859718 20:62143687-62143709 CGCGGGGGGCGCCGCGTCGTGGG - Intergenic
1175926974 20:62475854-62475876 AGAGCGGGGCCCCGCCGCGCTGG + Intronic
1176135538 20:63520631-63520653 AGCTGGGGGCGCGGCCTCGCCGG + Intergenic
1176135721 20:63521199-63521221 AGCGGGTGGAGCCGCCGCGCTGG - Intronic
1178913420 21:36693864-36693886 AGCGGGGCCCGCCTGCCCGCCGG + Intergenic
1178992689 21:37367848-37367870 AGCGGGGGCCGCGGCCTCCCGGG + Intronic
1179953232 21:44723573-44723595 AGTGGGGGCTGCGGCCCCGCCGG - Intergenic
1180516098 22:16146613-16146635 AGCGGGGTGCGCCTCCTCACGGG - Intergenic
1181084089 22:20431358-20431380 AGCGGCACGCGCCGCTCCGCGGG + Exonic
1183294141 22:37019810-37019832 GGGAGGGGGCGCCGCGCCGCGGG + Intronic
1184035146 22:41914664-41914686 AGCGGGAGGCGCGGGCCCGATGG - Exonic
1184169792 22:42752132-42752154 AGGGTGGGGGGCCGCCCTGCAGG + Intergenic
1185313938 22:50170704-50170726 GGCGGGGGGCGCGGCCCGGCGGG - Intergenic
949883786 3:8679443-8679465 AGCGGGGGGAGGCACCCCCCGGG + Intronic
950829401 3:15859554-15859576 AGGGGGCGGCGCCGCCTCCCCGG + Exonic
952377656 3:32780901-32780923 AGAGGGGGGCGGCGCCCCGGGGG + Intergenic
952867160 3:37861909-37861931 AGCGGGAGGCCCGGCGCCGCTGG - Intergenic
960227489 3:115184931-115184953 AGCAGGGGGCGGCGCTCCTCAGG + Intergenic
961932272 3:130547108-130547130 AGCAGGGGGCGACGCCCATCTGG + Intergenic
964129313 3:153269038-153269060 AGCAGGGGGCGACGCCCATCGGG - Intergenic
964771257 3:160226001-160226023 TCCGGGGGGCGCCGGACCGCTGG + Exonic
966425428 3:179775562-179775584 AGCAGGGGGCGGTGCCCCTCGGG + Intronic
966806459 3:183811434-183811456 AGTGGGGAGCGGCGCCCGGCAGG + Exonic
968453865 4:687548-687570 AGCGGCGGGCTCGGCTCCGCAGG - Intronic
968660141 4:1795431-1795453 GGGCGGGGGCGCCGCCCCGGGGG - Intronic
968690484 4:1987444-1987466 TGCGGGGGGCACAGCCCCACGGG + Intronic
968701408 4:2059709-2059731 GGCGGGGGGCGCGGGGCCGCCGG + Exonic
968735959 4:2296721-2296743 AGCAGCAGGTGCCGCCCCGCGGG - Intronic
969285435 4:6199735-6199757 AGCTGGGGGCCGCGCCCCGGCGG - Intronic
972396588 4:38663907-38663929 GGAGCCGGGCGCCGCCCCGCCGG - Intergenic
973142133 4:46781977-46781999 AGCAGGGGGCGGCGCCCATCAGG - Intronic
975148275 4:70993620-70993642 GGAGGGCGGGGCCGCCCCGCAGG + Exonic
978620767 4:110632839-110632861 AGCGAGGGGCGCTTCCCCGAGGG - Intronic
981920470 4:150079454-150079476 AGGGGAGGGCGCCGCACGGCAGG + Intronic
983425753 4:167581873-167581895 AGCAGGGGGTGGCGCCCCTCAGG - Intergenic
984667948 4:182448680-182448702 AGGGGAGGATGCCGCCCCGCGGG + Intronic
985657659 5:1140449-1140471 AGCAGGGAGCACCGCCTCGCTGG - Intergenic
986919073 5:12662221-12662243 AGCAGGGGGCGGCGCCCATCAGG - Intergenic
987355886 5:17062507-17062529 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
988500191 5:31777433-31777455 AGCAGGGGGCGGCGCCCGTCGGG - Intronic
990699394 5:58459661-58459683 AGCGGAGGGCGCCGGGCTGCCGG - Intronic
992042431 5:72848697-72848719 GGCCGGGGGCGCCGCCGCGTGGG + Intronic
992444031 5:76818918-76818940 AGCGGAGGGCGCAGCTGCGCAGG + Intronic
993770339 5:91917592-91917614 AGCAGGGGGCGGCGCCCATCGGG - Intergenic
993826224 5:92690268-92690290 GGTGGCGGGCGCCGCCACGCGGG + Intergenic
997302108 5:132813762-132813784 TGCGGGCGGCGCGGCCCCGCGGG - Exonic
998117586 5:139549661-139549683 AGCAGGGGGTGGCGCCCCGTCGG - Intronic
1002409194 5:179060670-179060692 AGCTGGGTGCGCCGGGCCGCTGG + Intronic
1002901889 6:1416555-1416577 TGCACGGGGCGCCGCCCCGGAGG + Intergenic
1003020629 6:2505814-2505836 AACAGGGGGCGCCGCCCAACAGG - Intergenic
1003061851 6:2870111-2870133 AGCAGTGGGCGGCGCCCAGCAGG + Intergenic
1003212425 6:4079355-4079377 AGTGGGCTGCGCAGCCCCGCGGG - Exonic
1003569472 6:7246761-7246783 CGCCGGGGGCGCGGCCTCGCAGG + Exonic
1004424430 6:15497779-15497801 AGTGGGGAGCGCTGCCCCTCTGG + Intronic
1005751259 6:28885177-28885199 AGCAGGGGGCGGCGCCCATCAGG + Intergenic
1006091478 6:31631495-31631517 AGCCAGGGGCCCCACCCCGCCGG + Exonic
1007327559 6:41073549-41073571 AGCGGGGGGCGCGGGCCCCGGGG - Intronic
1007809489 6:44476061-44476083 TGAGGGGGGCGCAGCCCAGCAGG - Intergenic
1007978859 6:46130035-46130057 AGTGGCAGGCGCCGCGCCGCGGG - Exonic
1010002027 6:70957281-70957303 AGCGGGAGGAGCGTCCCCGCGGG + Intergenic
1014931684 6:127343568-127343590 AGCGGAGGGCGCCTCGCGGCAGG - Intronic
1015440407 6:133241192-133241214 CGCGGGGGGCGGCGGCGCGCGGG - Intronic
1016433053 6:144008090-144008112 TCCGGGGGTCGTCGCCCCGCAGG - Intronic
1018624597 6:165765329-165765351 AGCAGGGGGCGGCGCTCCTCGGG + Intronic
1018686386 6:166307657-166307679 AGCTGCTGGCGCGGCCCCGCAGG - Exonic
1019509974 7:1412925-1412947 AGCGGCGGGCGAGGCCCCGCTGG - Intergenic
1021231113 7:18086964-18086986 AGCGGCGGGCGCGGCGCGGCCGG - Intronic
1021311821 7:19106566-19106588 TGCGCGGGTCTCCGCCCCGCGGG + Intronic
1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG + Intergenic
1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG + Exonic
1027070628 7:75157865-75157887 AGCGGGGGGCGCCGCCCCGCAGG - Intergenic
1027138245 7:75639317-75639339 CGGGGGAGGCGCGGCCCCGCCGG + Intronic
1027868145 7:83673629-83673651 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
1028871066 7:95772434-95772456 AGGGGGTGGCGCCGCTCCGTAGG - Intergenic
1029037945 7:97541444-97541466 AGCAGGGGGCCCCGCCCCATGGG - Intergenic
1030780461 7:113593636-113593658 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
1030980648 7:116182025-116182047 AGCAGGGGGCGGCGCTCCTCGGG + Intergenic
1032344451 7:131106212-131106234 AGCCGGGGGCGGCGGGCCGCCGG - Intergenic
1032782009 7:135170925-135170947 AGCCGGTGGCGCTGCCTCGCTGG - Intergenic
1035264835 7:157684999-157685021 TCCGGGGGACGCGGCCCCGCAGG - Intronic
1035401646 7:158569921-158569943 AGCGCGGGGCGGCGCCCTCCCGG + Intronic
1035403942 7:158586840-158586862 AGCGGGGGGCGCACCCACGCCGG + Intronic
1036915024 8:12796581-12796603 AGCAGGGGGCGGCGCCCTTCCGG - Intergenic
1037305185 8:17497130-17497152 AGCAGCGGCCGCCGCCTCGCTGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1042292944 8:67188742-67188764 AGCAGTGGGTGCCACCCCGCTGG - Intronic
1049345432 8:142136162-142136184 TGAGGAGGGCCCCGCCCCGCTGG + Intergenic
1049396346 8:142402942-142402964 GGCGGGGGGCGGGGCCGCGCCGG - Intronic
1049404841 8:142447729-142447751 AGGAGGGGGTGCCGCTCCGCAGG + Intergenic
1049506994 8:143008180-143008202 AGCAGGGGGCCCTGCCCCCCAGG - Intergenic
1049562207 8:143317475-143317497 AGCAGTAGGGGCCGCCCCGCAGG + Intronic
1049638944 8:143705637-143705659 AGAGGGAGGAGCCGGCCCGCGGG + Intronic
1049659987 8:143815569-143815591 GGCAGGGGGCGCGGCCCGGCGGG + Intergenic
1049801124 8:144517960-144517982 ATCGCGGGGCGCCGCGGCGCCGG + Intergenic
1049891387 9:73494-73516 GGCGCGGGGCGCCGACCTGCTGG - Intergenic
1050091298 9:2017667-2017689 AGCGGCGGGGGCCGGGCCGCGGG + Intronic
1051350277 9:16192354-16192376 AGCAGAGGGCGCCACCGCGCTGG + Intergenic
1053706214 9:40754733-40754755 AGCGGGGTGCGCCTCCTCACAGG + Intergenic
1054416290 9:64878338-64878360 AGCGGGGTGCGCCTCCTCACAGG + Intergenic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1058619116 9:106864206-106864228 AGCGGGGGGCACCGGCCGGGTGG + Intronic
1060186429 9:121566767-121566789 AGCGGGGAGCCCAGCCCCCCAGG - Intergenic
1061208751 9:129178689-129178711 AGGTGGAGGCGCCGCGCCGCTGG - Intergenic
1061307026 9:129738053-129738075 CGCGGGCGGGGCAGCCCCGCAGG + Intergenic
1061518019 9:131100791-131100813 GGCTGGGGGCGCTGCCCCTCAGG + Intronic
1062689740 9:137835049-137835071 AGCCGGCGGCGCAGCCCCGAAGG - Exonic
1187173002 X:16870006-16870028 CCCGGCGCGCGCCGCCCCGCAGG + Intronic
1188242718 X:27809608-27809630 AGCGGGGGGCGGCGCTCGTCAGG - Intronic
1188881877 X:35499596-35499618 AGCAGGGGGCGGCGCTCCTCGGG - Intergenic
1200058772 X:153474822-153474844 TGCGCGGGGCGCAGCCGCGCAGG + Intronic
1200093000 X:153644442-153644464 GGCTCTGGGCGCCGCCCCGCCGG - Intronic
1201728980 Y:17185650-17185672 AGCAGGGGGCGGTGCCCAGCAGG + Intergenic