ID: 1027023177

View in Genome Browser
Species Human (GRCh38)
Location 7:74830660-74830682
Sequence GTCCATGTGTACCCAAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 2, 1: 6, 2: 30, 3: 87, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027023177_1027023182 -7 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023182 7:74830676-74830698 CATGGACATAAAGATGGGGATGG 0: 3
1: 0
2: 11
3: 39
4: 355
1027023177_1027023186 22 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023186 7:74830705-74830727 TAGACACTGGTGGCTCCTAGAGG 0: 3
1: 0
2: 23
3: 178
4: 939
1027023177_1027023187 29 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023187 7:74830712-74830734 TGGTGGCTCCTAGAGGAAAGAGG 0: 3
1: 0
2: 5
3: 27
4: 306
1027023177_1027023183 -6 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023183 7:74830677-74830699 ATGGACATAAAGATGGGGATGGG 0: 3
1: 0
2: 1
3: 39
4: 301
1027023177_1027023185 12 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023185 7:74830695-74830717 ATGGGAACAATAGACACTGGTGG 0: 13
1: 52
2: 117
3: 198
4: 441
1027023177_1027023184 9 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023184 7:74830692-74830714 GGGATGGGAACAATAGACACTGG 0: 6
1: 14
2: 296
3: 2186
4: 7252
1027023177_1027023188 30 Left 1027023177 7:74830660-74830682 CCAAACCTTGGGTACACATGGAC 0: 2
1: 6
2: 30
3: 87
4: 231
Right 1027023188 7:74830713-74830735 GGTGGCTCCTAGAGGAAAGAGGG 0: 3
1: 0
2: 3
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027023177 Original CRISPR GTCCATGTGTACCCAAGGTT TGG (reversed) Intronic
901420915 1:9150498-9150520 GTCCATGTGGCACCAAGGATGGG - Intergenic
904332521 1:29769831-29769853 GTCCATGTGAACCCAAGATTTGG + Intergenic
904702483 1:32366157-32366179 GTCCCTGTTTAGCCAAGGGTAGG + Intronic
905391297 1:37637174-37637196 GTACAGGTCTACACAAGGTTTGG - Intergenic
908105802 1:60840781-60840803 GTCCATGTGTACTGAATATTTGG - Intergenic
908846953 1:68334324-68334346 GTCCATGTGTACCCAATGTTCGG + Intergenic
909961763 1:81854848-81854870 GTCAATGTGTGCCGAAGGTGAGG + Intronic
910644319 1:89496915-89496937 GTCCATGTGTTCTCATTGTTCGG - Intergenic
911370957 1:96994413-96994435 GTCCATATTTACCCAAAGTGGGG + Intergenic
913342700 1:117775274-117775296 GTCCATGTGTTCTCATTGTTTGG - Intergenic
916024764 1:160823937-160823959 GTCCATGTTTACCAAACCTTGGG + Intronic
916894306 1:169146135-169146157 GTCCATGTGTAACCATTGTTTGG + Intronic
918100657 1:181370479-181370501 GCCCCTGTGTACTCAATGTTTGG + Intergenic
918947618 1:191089937-191089959 GTCCATGAATACCCAATGTGTGG - Intergenic
923290559 1:232541037-232541059 GTCCATGTGTTCTCATTGTTTGG - Intronic
924650367 1:245920652-245920674 TTCTATGTGTAGGCAAGGTTGGG - Intronic
1064075266 10:12263829-12263851 GCCCATGTGTACCCTATGTTTGG + Intergenic
1064299184 10:14107141-14107163 GTCCATGAGTACCCAGTGTTTGG - Intronic
1064515869 10:16147311-16147333 GCCCATGTGTACCCAATGTTTGG - Intergenic
1064921295 10:20521891-20521913 GTCCATGTGTACCCGATGTTTGG + Intergenic
1064959054 10:20943382-20943404 GTCCATGTGTTCTCATTGTTCGG - Intronic
1066007981 10:31165665-31165687 GTCCATGTGTGCCCATGCCTGGG - Intergenic
1066188891 10:33037315-33037337 GTCCATGGGTGGCCATGGTTGGG - Intergenic
1066508232 10:36066829-36066851 GTCCATGGGTAGCCATGGTTGGG - Intergenic
1068023160 10:51609779-51609801 GTCCATGTGTTCTCATTGTTAGG - Intronic
1068137510 10:52965364-52965386 GTCCATGGGTAGCCATGGGTGGG + Intergenic
1071023378 10:81083811-81083833 GTCCATGTGTAGCGGAGGTGAGG + Intergenic
1071237818 10:83669545-83669567 GTCCATGTGTTCTCAACATTCGG + Intergenic
1071339935 10:84636280-84636302 GTCCATCTGTACTCAATGTATGG + Intergenic
1071564158 10:86663014-86663036 GTCCAGGTGTGCCCAGGGATGGG + Intronic
1073018708 10:100422994-100423016 GTTCATATGTACCCGATGTTTGG + Intergenic
1073019068 10:100425968-100425990 GTTCATATGTACCCGATGTTTGG - Intergenic
1073645858 10:105302985-105303007 GTCCATGTGTACCCAATGCTTGG + Intergenic
1074270393 10:111947857-111947879 GTCCATGTGTTCCCATCATTTGG - Intergenic
1075230926 10:120677091-120677113 GTCCATGTGTTCTCATTGTTTGG - Intergenic
1076264426 10:129098725-129098747 GGCCATGTGTGCCCAAAGGTGGG + Intergenic
1077162911 11:1121751-1121773 GTCCTCGTGTACCCCAGGGTTGG + Intergenic
1077490521 11:2858873-2858895 GTCCATGTGTCCCCATGCCTTGG - Intergenic
1077694557 11:4382613-4382635 GTCCATGAGTACCCTGTGTTTGG + Intergenic
1078044550 11:7901463-7901485 GTCCATGTGTACTCAATGTTTGG + Intergenic
1078524415 11:12089760-12089782 GTCCATGTGTTCCCATTGTTTGG - Intergenic
1078805432 11:14695716-14695738 GTCCATGTGTTCTCACTGTTTGG + Intronic
1078984754 11:16582101-16582123 GTCCATGTTTACCCAATGTTTGG - Intronic
1079195820 11:18326132-18326154 GACCATTTGTGCCCAATGTTCGG + Intronic
1079474475 11:20814498-20814520 GTCCATATGTACCCAATGTTCGG + Intronic
1079563165 11:21848126-21848148 GTCCATGTGTTCCCACTGTTCGG + Intergenic
1079829746 11:25248292-25248314 GTCCATGTATACTCAATGTGTGG + Intergenic
1080973856 11:37311248-37311270 ATCCACGTGTACTCAATGTTTGG + Intergenic
1081082244 11:38756569-38756591 GTCCATGGGTAGCCAAGGGTGGG + Intergenic
1081306101 11:41514140-41514162 GTCCATGTGTTCCCATCCTTCGG - Intergenic
1081485571 11:43525332-43525354 GCCCATGTGTACTCCATGTTTGG + Intergenic
1082797348 11:57387748-57387770 GGCCCTGTGTACCCGAGGTGAGG - Exonic
1083075591 11:60033685-60033707 CTCCACGTGTACTCAAGGTCTGG - Intergenic
1086041746 11:82487465-82487487 ATCCATGAGTACCCAATGTTTGG + Intergenic
1086565846 11:88224802-88224824 GGCCATGTGTACCCAGTGCTTGG + Intergenic
1086944889 11:92835198-92835220 GTCCATTTGTCCCCAAGAATAGG + Intronic
1087849835 11:103015588-103015610 GTCCATGTGTACCCACTGTTTGG + Intergenic
1088736905 11:112735244-112735266 GTCAATGTGTAGCCAAGTTTGGG - Intergenic
1088809276 11:113379349-113379371 GTCTATGTATACCTAAGGTTTGG + Intronic
1090999941 11:131901977-131901999 GCCCATGTCAACCCCAGGTTGGG + Intronic
1093899912 12:24620024-24620046 GTCCATGTGTTCTCATTGTTCGG + Intergenic
1094405626 12:30112975-30112997 GTCCATGTATGCCCAATGTTTGG + Intergenic
1094524625 12:31223334-31223356 TTTCTTGTGTACCCAAGGTGAGG - Intergenic
1095124601 12:38461976-38461998 GTCCATGTATACTCACTGTTTGG - Intergenic
1095341809 12:41098479-41098501 GTCCATGTGTTCTCATCGTTCGG - Intergenic
1095350066 12:41199804-41199826 GTCCATGTGTGCACATTGTTTGG - Intronic
1096346836 12:50856000-50856022 GTCCATGTGTACTCAATGTTGGG - Intronic
1097596521 12:61639438-61639460 GTCCATGCATACCCACTGTTTGG + Intergenic
1098048318 12:66425764-66425786 GTCCATGTGTTCTCATTGTTCGG - Intronic
1098129052 12:67329117-67329139 GTCCGTGTATAGCCAATGTTTGG + Intergenic
1098738011 12:74131933-74131955 GTCCATGTGTACTCAATGTTTGG + Intergenic
1098801948 12:74971772-74971794 GACTATGTGTACTCAATGTTTGG - Intergenic
1100022031 12:90080940-90080962 GTCCCTGTGTACCCATTGTTTGG - Intergenic
1100169467 12:91957889-91957911 GTCCATGTGTTCTCATTGTTTGG - Intergenic
1100320942 12:93491817-93491839 GTCCGTGTGTACCCAGTGTTTGG + Intronic
1101759120 12:107644778-107644800 GTCCATGTGTACTCAATGTTTGG + Intronic
1101921749 12:108938706-108938728 GGGTATGTGTACCCAAGGTGGGG - Intronic
1102380036 12:112457249-112457271 GTCCATGTGTTCTCATTGTTTGG + Intronic
1103229358 12:119315150-119315172 GTCCATGTGTACCCAACATTTGG + Intergenic
1105008618 12:132739046-132739068 GTCCATGTGTGCTCAGCGTTTGG - Intronic
1107067152 13:36226735-36226757 GTCCATGAGTACCCAGTGTTTGG - Intronic
1107155762 13:37165449-37165471 GTCCACGTGTACCCATGGTTTGG + Intergenic
1107158263 13:37195340-37195362 GTCCACATGTACCCAATGTTTGG + Intergenic
1107366323 13:39681578-39681600 GTCCTTGTGTACCAAAGGTTGGG + Intronic
1107661117 13:42640365-42640387 GTCCATGTGTTCTCATTGTTTGG + Intergenic
1109863259 13:68227356-68227378 GTCCATGTGTACCCATTGTTTGG - Intergenic
1110985548 13:81962997-81963019 GTCCATGTGTACCCAACATTTGG - Intergenic
1110986795 13:81981650-81981672 GTCCATGTGTAACCAAACTCAGG + Intergenic
1111126821 13:83920380-83920402 GTCCATGTGTACCCTATGTTAGG - Intergenic
1111194181 13:84850992-84851014 GTCCATGTGTACTCAGTGTTTGG - Intergenic
1111465141 13:88598492-88598514 GTCCATGAGAACTCAATGTTTGG - Intergenic
1111550175 13:89798930-89798952 GTCCACGAGTACCCAGTGTTTGG + Intergenic
1112773554 13:102819546-102819568 GTCCATGTGTTCACATTGTTCGG - Intronic
1118946580 14:70393745-70393767 GTCCATGTGTTCTCATTGTTCGG - Intronic
1119016720 14:71064816-71064838 GTCCATGTGTTCTCACTGTTCGG + Intronic
1119876826 14:78066933-78066955 GTTCATGTGTACTCAATGTTTGG + Intergenic
1120124757 14:80728302-80728324 GTCCATGTGTACTCATGTTCAGG - Intronic
1120246662 14:82014451-82014473 GTTCATGTGTACCCATTCTTTGG - Intergenic
1121187012 14:91982401-91982423 GTCCGTATGTACCCAATGTGTGG - Intronic
1122036417 14:98952398-98952420 GTCTATGTGTACTCAATGTTCGG - Intergenic
1124700931 15:31911246-31911268 GTCCATAAGTACCCAATGTTGGG - Intergenic
1125302564 15:38271956-38271978 GTCCAGGAGTACCCAATATTTGG + Intronic
1125994617 15:44146201-44146223 GTCCATGTGTTCTCATTGTTTGG + Intronic
1126839444 15:52702549-52702571 GTCCATGAGTACCCAATCTTTGG - Intronic
1127145642 15:56020216-56020238 GTCCATGAGTACCCAATATTTGG + Intergenic
1127218149 15:56847020-56847042 GTCCATGTGTACACATTGTTTGG + Intronic
1127865743 15:63031211-63031233 GTCCATGTGTACACATGCCTTGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1133865855 16:9642846-9642868 GTCCATGAGTACCGAGTGTTTGG - Intergenic
1134761678 16:16720094-16720116 GTCCATGTGTACCCTTTGTTTGG + Intergenic
1134984379 16:18639076-18639098 GTCCATGTGTACCCTTTGTTTGG - Intergenic
1135110048 16:19683499-19683521 GCCCATGGGTACCCAATGCTTGG + Intronic
1135150818 16:20003916-20003938 GTCTATGTGTACCTAAAGTCTGG - Intergenic
1135823625 16:25706581-25706603 GTCCATGTGTTCTCACTGTTCGG + Intronic
1137951666 16:52789663-52789685 GTATATGAGTACCCAATGTTTGG + Intergenic
1137953553 16:52806520-52806542 GTCCATGTGTACCCATTGTTTGG + Intergenic
1139275405 16:65723240-65723262 GTCCATGTGTACTCAACATTTGG + Intergenic
1144121788 17:12161861-12161883 GTCCATATGTACTCAATGCTTGG + Intergenic
1146288995 17:31594771-31594793 TTCCCTGTGGCCCCAAGGTTTGG + Intergenic
1147913381 17:43871433-43871455 GTCCATGTGTACCCAATGTTTGG + Intergenic
1151494180 17:74449678-74449700 GTCCCTGTGTCCCCAAGCTGTGG + Intronic
1152516281 17:80826653-80826675 GTCACTGTGTCCCCATGGTTGGG + Intronic
1153329137 18:3855222-3855244 GTCCATATGTACTTAATGTTTGG - Intronic
1153654522 18:7271197-7271219 GTCCGTGAGTACTCAATGTTTGG - Intergenic
1153817678 18:8805307-8805329 GTCCGAGTATACCCAATGTTTGG + Intronic
1154023842 18:10688205-10688227 GTCCATGTGTTCTCATTGTTCGG + Intronic
1154397877 18:14008328-14008350 GTCCATGTTTAGCCAGAGTTTGG + Intergenic
1155613259 18:27692980-27693002 GTCCATGGGTACTCAGTGTTTGG + Intergenic
1156058637 18:33044953-33044975 GTCCATATGTAGCCATTGTTTGG - Intronic
1156429343 18:37054603-37054625 ATCCATGTGTACTCATTGTTTGG - Intronic
1157638676 18:49189095-49189117 GTCCATGTGTACCCAGTGTTTGG - Intronic
1157796031 18:50576430-50576452 GTCCATGTGTACTCAATGTTTGG - Intronic
1157811670 18:50701317-50701339 GACCATGTGAACACAAGGTTAGG - Intronic
1158550950 18:58435892-58435914 GTCCATGTGTTCTCATTGTTCGG - Intergenic
1158577549 18:58651700-58651722 GTCCATGTGTTCTCACTGTTCGG + Intergenic
1159154919 18:64571267-64571289 GTCCATGTGTTCTCAATGTTCGG + Intergenic
1159694359 18:71536023-71536045 GTCCATGGGTTCTCAATGTTCGG + Intergenic
1163212812 19:15853871-15853893 GTCCATGTGTTCTCATTGTTTGG - Intergenic
1164499084 19:28797894-28797916 GTCCATCTGTATCTAAGATTTGG + Intergenic
1164521687 19:28984617-28984639 GTGCATGTGGAACCAAGGTTTGG - Intergenic
1164922668 19:32101100-32101122 GTCCATGAGTACCCAATGTTCGG + Intergenic
1165045167 19:33098833-33098855 GGGCATGTGTACCCAGTGTTAGG + Intronic
1165202474 19:34156448-34156470 GTCCATGTGTACACATTATTTGG - Intergenic
1168188620 19:54720880-54720902 GTTCATGTGTATTCAATGTTTGG - Intergenic
926443876 2:12920566-12920588 GTCCATGTGTTCTCATTGTTCGG + Intergenic
928597746 2:32872281-32872303 GTCCATATGTACCCAATATTTGG - Intergenic
929048204 2:37811370-37811392 GTCCATGTGTACACATTATTTGG + Intergenic
929630233 2:43452596-43452618 GTTCATGTGTCCCCATGGTTTGG + Intronic
930312409 2:49757831-49757853 GTCCATGAATACACAATGTTTGG - Intergenic
930431681 2:51285261-51285283 TTCAATCTGTACACAAGGTTTGG + Intergenic
932522086 2:72425038-72425060 GTCCATGTGTTCTCAACATTTGG + Intronic
934811393 2:97281057-97281079 GTCCATGTGTTCTCATTGTTCGG - Intergenic
934826298 2:97426883-97426905 GTCCATGTGTTCTCATTGTTCGG + Intergenic
934907769 2:98220912-98220934 GTCCATGTGTTCTCATTGTTCGG - Intronic
936439285 2:112536730-112536752 GTCCATGTGTATCTAATGTTTGG + Exonic
937462072 2:122098099-122098121 GTCCATGTGTCCACAAGGGAAGG - Intergenic
938158212 2:128959297-128959319 GTCCATGTTTGCCCAAGACTAGG - Intergenic
938690637 2:133786023-133786045 GTCCATGTGTTCTCATTGTTCGG - Intergenic
938810793 2:134850997-134851019 ATCCATGTAAACCCAATGTTTGG + Intronic
939593322 2:144093571-144093593 TACCATGTGTAGCCAAGTTTTGG - Intronic
939612343 2:144326806-144326828 GATCATGTGTACCCCAGGGTTGG - Intronic
939859667 2:147403179-147403201 ATCAATGTGTACCCAGTGTTTGG + Intergenic
940412553 2:153382376-153382398 GTTCATGAGTACCCAATGTTTGG + Intergenic
942353783 2:175084436-175084458 GTCCATGTGTTCTCATTGTTCGG - Intronic
942741954 2:179191370-179191392 GTCCATGTGTGCCCAATGTTTGG - Intronic
943446234 2:187991652-187991674 GTCCATGTGTATTCAATGTTTGG - Intergenic
943968217 2:194366909-194366931 GTCCATGTGTGCTCAATGTTTGG - Intergenic
947007162 2:225525561-225525583 GTCCATGTGTACCCATTGTTTGG - Intronic
947057498 2:226123098-226123120 GTCCATGAGTACCCAATGTTTGG + Intergenic
947879953 2:233499208-233499230 GTCCATGTGTTCTCATTGTTTGG + Intronic
948661210 2:239507800-239507822 GCCCATGTGTCCCCATGGGTGGG - Intergenic
1169667500 20:8054111-8054133 GTCCATGTGTTCTCACTGTTCGG + Intergenic
1169941499 20:10942657-10942679 GTCCATGTGTACCCAATGCTTGG + Intergenic
1170300255 20:14875685-14875707 GTCCATGTGTGCCCAGTGTTTGG + Intronic
1171945528 20:31373783-31373805 GTCCATGTGTGATCAAGGCTTGG - Exonic
1173517663 20:43676319-43676341 GTCCATGTGTATTCAGTGTTTGG + Intronic
1174533719 20:51234795-51234817 GTCCATGTGTTCTCATTGTTTGG + Intergenic
1174880551 20:54274427-54274449 GTCCATGTGTTCTCACTGTTTGG + Intergenic
1177205478 21:18005773-18005795 GTCCATGTGTGCTCATTGTTCGG - Intronic
1177368614 21:20172268-20172290 ATCCACGTGTACCCAGGTTTTGG + Intergenic
1177769043 21:25494034-25494056 GTCCATGAGTGCCCAAAGTTCGG - Intergenic
1178142716 21:29702085-29702107 GTCCATGTGTTCCCATCATTTGG - Intronic
1179193897 21:39147105-39147127 GTCTGTGTGTACCCAATATTTGG + Intergenic
1180855622 22:19043010-19043032 GTGCGTGTGTACCCAATGTGTGG - Intronic
1181557412 22:23679219-23679241 GTCCATGTGTACCCAGTGCTTGG - Intergenic
1182095990 22:27626227-27626249 GTCCCTGTGCAGCCAAGGGTGGG - Intergenic
950329276 3:12143489-12143511 GTCTATGTGTACCCATTATTTGG + Intronic
951631913 3:24731358-24731380 GTCCATGTGTACTCAATGTTTGG - Intergenic
951835771 3:26981963-26981985 GTCCATCTGGGCCCCAGGTTAGG + Intergenic
952121887 3:30255063-30255085 GTCCATGTGTTCTCAATGTTTGG + Intergenic
954139557 3:48597865-48597887 CTCCATGAGCACCCAGGGTTGGG + Intergenic
955958798 3:64317880-64317902 GTCCATGTGGACCCATTCTTGGG + Intronic
958126315 3:89360687-89360709 GTCCATGTGTTCTCAAGGCAAGG - Intronic
959221158 3:103522115-103522137 GTCCATGTGTACTGAGTGTTTGG - Intergenic
961320754 3:126073053-126073075 ATGCATGTGTACCCAATGTTTGG - Intronic
962478315 3:135777300-135777322 GTCCATGTGTACTTAATGTTTGG - Intergenic
962926592 3:139999306-139999328 GTCCATGTGTGCTCAGTGTTTGG + Intronic
963931781 3:151011061-151011083 ATCCATGTGTATCCATTGTTTGG - Intergenic
964127331 3:153248899-153248921 GTCCATGTGTTCTCATTGTTTGG + Intergenic
964252211 3:154731462-154731484 GTCCATGAGTACCCAATATTAGG - Intergenic
965239799 3:166181041-166181063 GTGGATGTGTACCATAGGTTAGG + Intergenic
965534232 3:169808405-169808427 GACCAGGAGTACCCAAGCTTGGG - Intronic
970184368 4:13434103-13434125 GTCCATGTGTACCCAGTCTTTGG - Intronic
972256674 4:37363577-37363599 GTCCATGAGTACCCAATTTTTGG - Intronic
973089311 4:46112732-46112754 GTTCATGAGCACCCAATGTTAGG - Intronic
973121754 4:46529737-46529759 ATCCATGAGTACTCAATGTTTGG + Intergenic
973164792 4:47063827-47063849 GTCCATGTGTTCTCATTGTTCGG - Intronic
973844512 4:54897418-54897440 GTCCATGTGTACCAATTATTGGG - Intergenic
974637827 4:64588714-64588736 GTCTATGTGTACCCCATGTTTGG - Intergenic
974703079 4:65476522-65476544 GTCAATGAGTTCCCAATGTTTGG - Intronic
975598010 4:76068568-76068590 GTCCATGTGTTCTCATGATTTGG - Intronic
976340289 4:83939624-83939646 GTCCATGAGTACCTAATGTCTGG + Intergenic
977186856 4:93949873-93949895 GTCTATGAGTACCCAATGTTTGG - Intergenic
977562712 4:98548723-98548745 GTCCATGTGTACCCATCATTTGG + Intronic
977707091 4:100084192-100084214 GTCCATGAGCACCCAGTGTTTGG + Intergenic
978054226 4:104243356-104243378 GTCCATGTATACTCAATGTTTGG + Intergenic
978062943 4:104360625-104360647 GTCCATGTATACACATGTTTAGG - Intergenic
978803676 4:112778532-112778554 ATCCATGTGTAGCTAAGGGTTGG + Intergenic
978997785 4:115177660-115177682 GTCCATGTGTTCTCATTGTTCGG - Intergenic
979053332 4:115964594-115964616 GTCCATATGTATCCATTGTTTGG - Intergenic
979339480 4:119504150-119504172 GTCCGTGTGTACCTACTGTTTGG + Intronic
979738940 4:124126013-124126035 GTCCATGTGTTCTCATTGTTCGG + Intergenic
980282745 4:130741696-130741718 GTCCATGTGTACCCAATGTTTGG + Intergenic
980329616 4:131393432-131393454 GTTCATGTGTACCCATTATTTGG + Intergenic
980689320 4:136273857-136273879 GTCCGTGTGTACTCGATGTTTGG - Intergenic
981739890 4:147990714-147990736 GTCCCTATGTACTCAATGTTTGG - Intronic
981884766 4:149660774-149660796 GTCCATGTGTTCTCATTGTTCGG - Intergenic
981959587 4:150520727-150520749 GTCCATGAGTACTCAATGGTTGG - Intronic
982613263 4:157605407-157605429 GTCCATGACTACCCAGTGTTTGG - Intergenic
982745095 4:159098379-159098401 GTCCAGCTATACCCAAGATTAGG - Intergenic
988202273 5:28083430-28083452 GTCCATGGGTAGCCATGGGTGGG - Intergenic
988238818 5:28581300-28581322 GTCCATTTGTATTCAATGTTTGG - Intergenic
989722466 5:44545814-44545836 GTCCATGTGTTCTCATTGTTCGG - Intergenic
991300589 5:65125656-65125678 GTCCATGTGAACACAAGGCAGGG - Intergenic
991561676 5:67960133-67960155 GTCCATGAGCACCCAGTGTTTGG + Intergenic
992519767 5:77538504-77538526 GTCCAGGTGTATCCAATGCTTGG + Intronic
993273916 5:85831793-85831815 GTTCATATGTACTCAACGTTTGG - Intergenic
993671185 5:90763726-90763748 GTCCATGTGTATCCATTGTCTGG + Intronic
994214122 5:97117901-97117923 TTCCATTTGTAACCAATGTTTGG - Intronic
995849430 5:116529782-116529804 GTCCATGTGTACTCAGTGTCTGG - Intronic
996088719 5:119329794-119329816 GTCCATGTCTAGACAAGGCTGGG - Intronic
996088724 5:119329824-119329846 GTCCATGTCCAGACAAGGTTTGG + Intronic
997045135 5:130307073-130307095 GTCCATGTGTACCCATTGTTTGG - Intergenic
1000534265 5:162460775-162460797 GTCCATGTGTACCCATTGTTTGG - Intergenic
1000745400 5:165026585-165026607 GTCCATGTGTACTCAGTGTTTGG - Intergenic
1001178883 5:169499680-169499702 ATCCATGTGTACTCAATGTTTGG + Intergenic
1001309837 5:170602889-170602911 CTGCATGTGGTCCCAAGGTTCGG + Intronic
1002333405 5:178461183-178461205 GTCCTTGTGGCCACAAGGTTGGG - Intronic
1003993044 6:11506807-11506829 GTTCATATGTACTCAATGTTCGG - Intergenic
1003993824 6:11517582-11517604 GTTCATGTGTACCCATTGTTTGG - Intergenic
1005041311 6:21602831-21602853 CTCCATTTCTACCCAAGGCTTGG + Intergenic
1005802572 6:29441785-29441807 GTTCATGTGTACTCAGTGTTAGG + Intronic
1005968825 6:30745143-30745165 GTCCACGAGTTCCCAATGTTTGG + Intergenic
1005968884 6:30745598-30745620 GTCCATGAGTTCCCAATGTTTGG - Intergenic
1006863812 6:37192233-37192255 GTTTATGTGTCCCCAAGTTTAGG + Intergenic
1008345763 6:50424485-50424507 GTCCATGTGTTCTCATTGTTTGG - Intergenic
1008823107 6:55657849-55657871 GTCCATGTGTTCTCATGTTTTGG - Intergenic
1008871358 6:56276160-56276182 TACCATGTGTACACAATGTTTGG - Intronic
1008890215 6:56479716-56479738 GTCCATGTGCGCCCATTGTTTGG - Intronic
1009636952 6:66278924-66278946 GTCCATGTGTACTCAGTGTTTGG + Intergenic
1009915563 6:69991093-69991115 GTCTATGTGTACTCAGTGTTTGG + Intronic
1010629899 6:78186737-78186759 GTCCATGTGTACCCAATGTTTGG + Intergenic
1010939873 6:81904273-81904295 GCCCATGTGTACTCAATGTTTGG - Intergenic
1011158340 6:84358680-84358702 GTCCATGTGTGCCCAATGTTTGG + Intergenic
1011378154 6:86712968-86712990 GTCCATGAGTATCCAATGTTTGG + Intergenic
1011742557 6:90376895-90376917 GTCCAAGTGCCCCCAAGGTCTGG - Intergenic
1013573923 6:111460208-111460230 GTCCATATGTACTCATGGTTTGG - Intronic
1013941130 6:115664251-115664273 GTCCATGTGTGCTCACTGTTTGG - Intergenic
1015943563 6:138476438-138476460 GTCCATGTGTACCAATTGTTTGG - Intronic
1016730117 6:147419958-147419980 GTCCATGTGTTCTCATTGTTCGG - Intergenic
1020545243 7:9520236-9520258 GTCCATATGTACTCAATGTTTGG - Intergenic
1021138641 7:16996007-16996029 GTCTATGGGTACCCAATGGTTGG + Intergenic
1023409650 7:39876920-39876942 GTCCATGTGTACCCAGTGGTTGG + Intergenic
1023497147 7:40809823-40809845 GTTCCTGAGTACCCAATGTTTGG + Intronic
1024252890 7:47519724-47519746 GTCCATGCTCACCCTAGGTTAGG + Intronic
1025043217 7:55666635-55666657 GTCCATGTGTACCCAGTGGTTGG - Intergenic
1025136136 7:56415158-56415180 GTCCATGTGTACCCAGTGGTTGG - Intergenic
1026782415 7:73277839-73277861 GTCCATGTGTACCCAAGGTTTGG - Intergenic
1027023177 7:74830660-74830682 GTCCATGTGTACCCAAGGTTTGG - Intronic
1027064753 7:75114636-75114658 GTCCATGTGTATCCAAGGTTTGG + Intronic
1027715277 7:81661691-81661713 GTCTATATGTATCCAATGTTCGG - Intergenic
1028067526 7:86406015-86406037 GTCCATGTCTACCCAATGTTAGG - Intergenic
1028329402 7:89570375-89570397 GTCCATGTGTATTCAGTGTTTGG - Intergenic
1028531727 7:91845759-91845781 GGCAATGTGGACCCAAGGTTTGG + Intronic
1030298306 7:107950853-107950875 GACCATGTGAACCCTATGTTTGG - Intronic
1031167329 7:118244979-118245001 GTACATGTTTACCTAAAGTTGGG - Intergenic
1031792765 7:126130725-126130747 GTTCATGAGTACCCAATGTTTGG - Intergenic
1032394711 7:131581253-131581275 GGCCATGAGAACCCAAGGGTGGG + Intergenic
1033000381 7:137497750-137497772 GTCCATGGGTACACAAAGGTGGG - Intronic
1033088206 7:138361683-138361705 CTCCAAGTGTCCCAAAGGTTGGG - Intergenic
1033112800 7:138597086-138597108 GTCCATCTGTACACATGCTTTGG + Intronic
1034723166 7:153314208-153314230 GTCCCTGGGTACTTAAGGTTAGG + Intergenic
1035910585 8:3561563-3561585 CTCCATGTGTACCCATTGTTTGG - Intronic
1036785171 8:11680940-11680962 GTCACTGTGTCCCCCAGGTTAGG + Intronic
1037357601 8:18039088-18039110 GTCCATGTGTGCCCAGTGTTTGG - Intergenic
1039309382 8:36299074-36299096 GTCCATGTGTACTTAATGTTTGG + Intergenic
1040985469 8:53289722-53289744 GTCCATGAGTACCCAATGCTTGG - Intergenic
1041295159 8:56349219-56349241 GTCCACGTGTACTCAATGTTTGG + Intergenic
1041864027 8:62547988-62548010 GGCCATGTGTACTCAAAGTACGG - Intronic
1042036142 8:64536187-64536209 GTCCATGTGTTCTCATTGTTCGG + Intergenic
1042515701 8:69656521-69656543 GTCCATGTGTTCTCAATGTTCGG + Intronic
1042984044 8:74564148-74564170 GTCCACGTGTACTCAATGTTTGG + Intergenic
1043015422 8:74934128-74934150 GTCCATGTGTTCTCATTGTTCGG + Intergenic
1043276580 8:78403842-78403864 TTCCTTGAGTACCCAAGGTAAGG + Intergenic
1044960839 8:97529246-97529268 GTCCATGTGTAGTTAATGTTTGG - Intergenic
1045998122 8:108387266-108387288 GTCCATGTGTTCTCATTGTTCGG - Intronic
1048403266 8:134092461-134092483 GTCCATGTGTATTCAAAGTTTGG - Intergenic
1048492521 8:134907091-134907113 GTCCATGTGTTCTCATTGTTCGG + Intergenic
1048629153 8:136221979-136222001 GTCCATGGGTGCTCAATGTTTGG - Intergenic
1049334425 8:142075434-142075456 GTCCATGTGTTCTCATTGTTCGG - Intergenic
1050295777 9:4203898-4203920 GTCCATGAGTACCCACTGTTTGG - Intronic
1050637954 9:7632446-7632468 GTCCATGTGTTCTCATTGTTTGG - Intergenic
1051554701 9:18369948-18369970 GTCCATGTGTACACATTGTTTGG - Intergenic
1051656790 9:19389840-19389862 GTCCATGTGTTCTCATCGTTCGG - Intergenic
1051704154 9:19859287-19859309 GTCCATGTGTCCTCATTGTTAGG - Intergenic
1052100544 9:24440920-24440942 GTCCATGTGTACTCACTGTTTGG + Intergenic
1052402566 9:28019066-28019088 GCCCATGTGTACTCAATGTTTGG - Intronic
1052568578 9:30190328-30190350 GTCCATGTGTTCTCATTGTTTGG + Intergenic
1053863250 9:42409211-42409233 GTCAATGTGTACTCAGTGTTTGG + Intergenic
1054796217 9:69304695-69304717 GCCCATGAGTACCCCATGTTTGG + Intergenic
1055829679 9:80363181-80363203 ATCCATGAGTACCCGATGTTTGG + Intergenic
1056055006 9:82812731-82812753 GGCCATGTGTACTCAATGTTTGG - Intergenic
1056192036 9:84194410-84194432 GTCCATGGGTAGCCATGGATGGG + Intergenic
1056230783 9:84540774-84540796 GTTCATGTGTACCCATTGTTTGG + Intergenic
1056794013 9:89644477-89644499 GTCCCAGTGTACCATAGGTTGGG - Intergenic
1059149625 9:111937716-111937738 GCCCATTTGGACCCCAGGTTTGG - Intergenic
1059784037 9:117561298-117561320 GTCTATCAGTACCCAATGTTTGG - Intergenic
1059797134 9:117710266-117710288 GTCCATGTGTACTCCATGTTTGG + Intronic
1062071938 9:134560434-134560456 CTCCAGGTGCACCCAAGCTTGGG - Intergenic
1185985529 X:4828278-4828300 GTCCATGTGTAGCCCATGTTTGG - Intergenic
1186030553 X:5364891-5364913 GTCCATGTGTACCCATTGTCTGG - Intergenic
1187448714 X:19378725-19378747 ACCCCGGTGTACCCAAGGTTGGG - Intronic
1188910701 X:35843505-35843527 GTCCATGTGTACTCAGTGTTTGG + Intergenic
1188936210 X:36178123-36178145 GTCCATGTGTACCCAATGTTTGG - Intergenic
1189480609 X:41389666-41389688 TTCCATGTGGCCCCCAGGTTGGG - Intergenic
1189596205 X:42568328-42568350 GTCCTTATGTACTCAATGTTTGG + Intergenic
1189794131 X:44631326-44631348 GTCCAAGTGTTCCCTAGGTGGGG - Intergenic
1190409676 X:50123928-50123950 ATCCATAAGTACCCAATGTTTGG + Intergenic
1190812186 X:53895572-53895594 ATCCATGTGTACTCAATCTTTGG - Intergenic
1192597556 X:72427539-72427561 GTCCATGTGTTCTCACTGTTCGG - Intronic
1193998058 X:88391147-88391169 GTACATGTGTACCAGATGTTTGG - Intergenic
1194394183 X:93360257-93360279 GTTCATGAGTACACAATGTTTGG - Intergenic
1196006935 X:110846772-110846794 GTTCATGTGTACCCATTATTTGG - Intergenic
1197000566 X:121434140-121434162 GTCTATGTGTACCCAGTATTTGG + Intergenic
1197115191 X:122823778-122823800 GTCCATGTGTCCTCATTGTTTGG - Intergenic
1197182022 X:123547157-123547179 TTCCATGTGTACCCATTGTTTGG - Intergenic
1197625568 X:128798515-128798537 GTCCATGTGTACTCCAAGTTTGG - Intergenic
1197866755 X:131027340-131027362 GTTCATGTGTATCCATTGTTTGG - Intergenic
1198217140 X:134566031-134566053 GTCCATGTGATCCTCAGGTTTGG - Exonic
1198280815 X:135140293-135140315 TTCCATGTATACTCAAGGTTTGG + Intergenic
1198290144 X:135232221-135232243 TTCCATGTATACTCAAGGTTTGG - Intergenic
1198327641 X:135589818-135589840 GTCCATGTGTTCTCATTGTTCGG - Intergenic
1200363032 X:155631145-155631167 GTCCATGTGTGCTCAGTGTTTGG + Intronic
1200812243 Y:7498403-7498425 GTCCATGACTACCTAAGGTTTGG - Intergenic
1201693223 Y:16792825-16792847 GTCCATGTGTAACCAATATTTGG + Intergenic
1202018742 Y:20441143-20441165 GTCCATGTGTTCTCAAGGTGTGG - Intergenic