ID: 1027026075

View in Genome Browser
Species Human (GRCh38)
Location 7:74852501-74852523
Sequence CTATGTGTGTTGAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027026071_1027026075 27 Left 1027026071 7:74852451-74852473 CCACTTTCACTCTCTCTCTCTTT No data
Right 1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027026075 Original CRISPR CTATGTGTGTTGAGGGGAGA TGG Intergenic
No off target data available for this crispr