ID: 1027036573

View in Genome Browser
Species Human (GRCh38)
Location 7:74930007-74930029
Sequence CACCCTATAGAGTTGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027036573_1027036580 15 Left 1027036573 7:74930007-74930029 CCTTCCAACAACTCTATAGGGTG No data
Right 1027036580 7:74930045-74930067 ATTAACAGAGAAGGAAAATGAGG No data
1027036573_1027036581 16 Left 1027036573 7:74930007-74930029 CCTTCCAACAACTCTATAGGGTG No data
Right 1027036581 7:74930046-74930068 TTAACAGAGAAGGAAAATGAGGG No data
1027036573_1027036577 6 Left 1027036573 7:74930007-74930029 CCTTCCAACAACTCTATAGGGTG No data
Right 1027036577 7:74930036-74930058 ATCACCCATATTAACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027036573 Original CRISPR CACCCTATAGAGTTGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr