ID: 1027041089

View in Genome Browser
Species Human (GRCh38)
Location 7:74962488-74962510
Sequence CCCAAACAGAAATGCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027041089_1027041094 13 Left 1027041089 7:74962488-74962510 CCCTGAATGCATTTCTGTTTGGG No data
Right 1027041094 7:74962524-74962546 TAGATTCTAAAGGCATAGATAGG No data
1027041089_1027041093 3 Left 1027041089 7:74962488-74962510 CCCTGAATGCATTTCTGTTTGGG No data
Right 1027041093 7:74962514-74962536 TCTGGATCTCTAGATTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027041089 Original CRISPR CCCAAACAGAAATGCATTCA GGG (reversed) Intergenic
No off target data available for this crispr