ID: 1027041727

View in Genome Browser
Species Human (GRCh38)
Location 7:74965492-74965514
Sequence CCGGCCCAACCGAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027041727_1027041736 -5 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041736 7:74965510-74965532 GCCGGCCCCGTCGCCACGGCGGG 0: 3
1: 0
2: 1
3: 12
4: 158
1027041727_1027041739 -3 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041739 7:74965512-74965534 CGGCCCCGTCGCCACGGCGGGGG 0: 3
1: 0
2: 0
3: 8
4: 88
1027041727_1027041747 18 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041747 7:74965533-74965555 GGGAGGGATTCCGCTGAGCGCGG No data
1027041727_1027041738 -4 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041738 7:74965511-74965533 CCGGCCCCGTCGCCACGGCGGGG 0: 3
1: 0
2: 1
3: 11
4: 110
1027041727_1027041734 -9 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041734 7:74965506-74965528 TTGGGCCGGCCCCGTCGCCACGG 0: 3
1: 0
2: 0
3: 6
4: 73
1027041727_1027041745 2 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041745 7:74965517-74965539 CCGTCGCCACGGCGGGGGGAGGG 0: 3
1: 1
2: 0
3: 4
4: 96
1027041727_1027041740 -2 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041740 7:74965513-74965535 GGCCCCGTCGCCACGGCGGGGGG No data
1027041727_1027041735 -6 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041735 7:74965509-74965531 GGCCGGCCCCGTCGCCACGGCGG No data
1027041727_1027041743 1 Left 1027041727 7:74965492-74965514 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1027041743 7:74965516-74965538 CCCGTCGCCACGGCGGGGGGAGG 0: 3
1: 1
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027041727 Original CRISPR CCGGCCCAACCGAGGGATGG GGG (reversed) Intronic