ID: 1027055268

View in Genome Browser
Species Human (GRCh38)
Location 7:75045454-75045476
Sequence CCAGGCCTGGGGATCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027055268 Original CRISPR CCAGGCCTGGGGATCACACC TGG (reversed) Intronic
900032414 1:381150-381172 CCAGGCCTGGGCATCTCCCCGGG - Intergenic
900052964 1:609336-609358 CCAGGCCTGGGCATCTCCCCGGG - Intergenic
900507034 1:3034889-3034911 CCAGGCCTGGGGCAGACACCTGG - Intergenic
901644725 1:10710276-10710298 CCAGGCATGGGGACCACATAGGG - Intronic
901678272 1:10899160-10899182 CCATGGCTGGGGAACAGACCAGG + Intergenic
902124958 1:14201641-14201663 CCAAGGCAGGGGATCTCACCTGG - Intergenic
902514880 1:16984826-16984848 GCAGGCCTGGGGATAGCACCAGG + Intergenic
902798490 1:18814860-18814882 CCAGGCCTGGGCATGAATCCTGG + Intergenic
902926691 1:19700592-19700614 CCAGGCCTGGTGATCTGATCTGG - Intronic
903345718 1:22682958-22682980 CCATGCCTGGAGTTCACTCCTGG + Intergenic
904458240 1:30660101-30660123 CCAGGCATGGGGTTCTCTCCTGG - Intergenic
904673706 1:32184465-32184487 CCAGGCCTGGAGGGGACACCTGG + Intronic
905473550 1:38210160-38210182 CCAGTCCTGGAGAGGACACCTGG + Intergenic
906675280 1:47688771-47688793 CCAGGCCTGGGGACAGAACCTGG - Intergenic
908358568 1:63345847-63345869 CCAGGCTTGGTGCTCACACCTGG - Intergenic
912381047 1:109248531-109248553 CCAGGCCAGGGCATCCCCCCAGG + Intergenic
915259881 1:154669781-154669803 CCAGGCATCTGGAGCACACCAGG - Intergenic
915488644 1:156239450-156239472 CCAGGCCTGGGGTTTCCCCCAGG - Intronic
915549731 1:156625084-156625106 CTTGGCCTGGGGACCACAGCGGG - Exonic
918084824 1:181236785-181236807 CCAGGTCTTGGGATCTCACCAGG - Intergenic
920192243 1:204201121-204201143 CCTGGCCAGGGGATGACACAGGG + Intronic
922090009 1:222387093-222387115 ACAGGCCTGGAGAACCCACCTGG + Intergenic
922856306 1:228777841-228777863 CCAGGCCTGGCCCACACACCTGG - Intergenic
924738817 1:246782567-246782589 CCAGGCCTGCAGAGCCCACCCGG - Intergenic
1064035123 10:11908480-11908502 CCAGGCCTGAGGATCCCAAGTGG + Intergenic
1064642337 10:17427364-17427386 GCTGGCCTGGGGACCACACTTGG + Intronic
1064644897 10:17450981-17451003 CCTGGCCTGGGTTTCACTCCAGG + Intronic
1065490673 10:26278821-26278843 ACTGGCCTGGGGATCTCATCTGG - Intronic
1067047164 10:42991264-42991286 CCTGGCCTGGGGTCCACACCTGG - Intergenic
1067080520 10:43209846-43209868 CCTGCTCTGGGGACCACACCTGG - Intronic
1067253568 10:44611303-44611325 CCATGCCTAGGGATCACACTGGG - Intergenic
1067318675 10:45197920-45197942 CCAGGCCTGGGGGGCCTACCCGG + Intergenic
1068697326 10:59981828-59981850 CCAGCAATGGGGATCATACCAGG - Intergenic
1069617080 10:69813216-69813238 CCAGGCCTAGAGATGACCCCTGG + Intronic
1069871466 10:71535709-71535731 CCTGCCCTGGGGCTCACATCAGG - Intronic
1071293828 10:84205176-84205198 CCAGGCCAGGGCATCGCATCTGG + Intronic
1071301428 10:84258649-84258671 CCTGGCCTGGGGCTCACTCCAGG - Exonic
1072805579 10:98422287-98422309 CCAGGCATGTGGATCACACCAGG + Intronic
1073948923 10:108784751-108784773 CCATGGCTGGGGGTCACACCTGG + Intergenic
1074964230 10:118474532-118474554 CCAGGGCTGGGGATGGCAGCTGG - Intergenic
1075390617 10:122088473-122088495 CCAGGCCTGGGGCTCTCTCTGGG - Exonic
1075561901 10:123474100-123474122 CCAGGCCAGTGGACCACACAGGG - Intergenic
1075924066 10:126236238-126236260 CCAGGCCTGTTGATGCCACCTGG - Intronic
1076024408 10:127100359-127100381 ACAGGCCTGGGCATCACACCGGG - Intronic
1076340955 10:129744546-129744568 TCAGGCATGGGGTTCACAGCAGG - Intronic
1076413148 10:130265851-130265873 CCTGGCCTGGGGATCCCACCGGG + Intergenic
1077107791 11:849548-849570 CGGGGCCTGGGGATGAAACCTGG - Intronic
1077235796 11:1481444-1481466 CCAGGCCTGGGGAGGCCACAGGG + Intronic
1077408884 11:2394481-2394503 CCAGGCCTGGGCTTCCCACAGGG - Intronic
1083711826 11:64554420-64554442 CCAGGCCTGGGCTTCAAAGCTGG - Intergenic
1083873475 11:65507007-65507029 CCAGGCGGGTGGATCACACGAGG - Intergenic
1084303552 11:68266812-68266834 TCGGGCCTGGGGAACATACCAGG - Intronic
1084975773 11:72797103-72797125 CAAGGCATGGGGATCACTCGAGG + Intergenic
1085319131 11:75563559-75563581 CCAGGGCAGGGGGTCACCCCAGG - Exonic
1085511750 11:77091691-77091713 CCAGGGCTAGGGATCAGGCCAGG + Intronic
1085521690 11:77142850-77142872 CCATGCCTTGGGGTCAGACCTGG + Intronic
1086855934 11:91865825-91865847 CCAGGCTTGGGGAAAACAACGGG + Intergenic
1089293831 11:117456188-117456210 GCAGCCCTAGGCATCACACCAGG - Intronic
1089518173 11:119046797-119046819 CCAGGCCTGTGGGTGAGACCAGG + Exonic
1089591657 11:119546014-119546036 CCAGGCCTGGGGTGCATAGCCGG + Intergenic
1089944437 11:122453712-122453734 CCAGACCTGGGCATCAACCCAGG + Intergenic
1091224496 11:133949592-133949614 CCAGGGCTGGGCTCCACACCTGG - Intronic
1091302391 11:134515757-134515779 CCTGGCATGGGGAGCACACCCGG + Intergenic
1092646325 12:10577468-10577490 CCACGACAGGTGATCACACCTGG - Intergenic
1093997635 12:25659022-25659044 CCAGACATTGGGATCACTCCTGG - Intergenic
1095874820 12:47068774-47068796 CCAGGCCTGGGCTTCACCGCAGG - Intergenic
1096847487 12:54415765-54415787 CCAGGCCAGAGGAGGACACCTGG + Intronic
1100455394 12:94746721-94746743 CCAAGCCTGCTGATCACAGCAGG + Intergenic
1100635526 12:96431442-96431464 CCAGGACTGGGGATCACCTGAGG + Intergenic
1101426702 12:104594187-104594209 GCAGGGCTGGAGATCACACCTGG - Intronic
1101894544 12:108746030-108746052 GCAGGACTGGTCATCACACCAGG - Intergenic
1101988583 12:109466547-109466569 CCAGGCCTGGGTTCAACACCTGG - Intronic
1102898895 12:116620820-116620842 CCAGCTCTGAGGATCACACGGGG - Intergenic
1102953055 12:117042659-117042681 CCTGCTCTGGGGATGACACCAGG + Intronic
1104588206 12:130064124-130064146 TCAGGCCTGGTGATAACACTGGG - Intergenic
1104844808 12:131841421-131841443 CCAGGCCTGGGAAGCCCAGCAGG + Intronic
1106360496 13:29026478-29026500 ACAGGCTTGGGGATCCCACTGGG - Exonic
1110419254 13:75286986-75287008 CCAGGCCTTGGAATCAAACCTGG - Exonic
1110525082 13:76526625-76526647 CAAGGTCAAGGGATCACACCTGG + Intergenic
1112084609 13:96016930-96016952 CAAGGCCTAGGGAGCCCACCAGG + Intronic
1113965470 13:114150572-114150594 CCTCACCTGGGGATCACACCTGG + Intergenic
1114061680 14:19023665-19023687 CCAGGCGTGAGGCTTACACCTGG - Intergenic
1114100581 14:19376341-19376363 CCAGGCGTGAGGCTTACACCTGG + Intergenic
1116516193 14:45809073-45809095 CCGAGCCTGGGGATCAGGCCTGG + Intergenic
1118355699 14:65011772-65011794 CCAGGGCTGTGGGTCACACGTGG + Intronic
1119777062 14:77256025-77256047 CCAGGCATGGGGACCATTCCTGG + Intronic
1120074979 14:80145828-80145850 TCTGGCCTGGTGATGACACCAGG + Intergenic
1121562586 14:94886100-94886122 CCACCCCTGGGGAGCACTCCAGG - Intergenic
1202897126 14_GL000194v1_random:16692-16714 CCAGGCCTCAGGGGCACACCAGG + Intergenic
1127752612 15:62060545-62060567 CAAAGCCTCGGGATCACAGCTGG - Intergenic
1127795666 15:62436372-62436394 CCAGGCCAGGGTAGAACACCAGG - Intronic
1129258038 15:74345285-74345307 CCAGGCCTGGTGAACACAGAGGG + Intronic
1129658721 15:77541486-77541508 CCAGCGCTGGGGGCCACACCCGG - Intergenic
1129682646 15:77666496-77666518 CCTGCCCTGGGGAGCACACAGGG + Intronic
1130600741 15:85271494-85271516 GCAGGCATGGGGTTCACAGCCGG - Intergenic
1130725317 15:86432981-86433003 CCAGTCCTGGTGATCATATCAGG + Intronic
1131107462 15:89744777-89744799 CCAGGTGTTGAGATCACACCTGG + Intergenic
1132335063 15:101042939-101042961 CCAGGCTGGGGGAGCACACGAGG + Intronic
1132457773 16:33616-33638 CCAGGAGTGGGGCTCACACAAGG - Intergenic
1132678786 16:1131308-1131330 CCAGGCCTGGGGAAGACCCGAGG - Intergenic
1132709039 16:1258498-1258520 CCAGGCCTGGGGTGTCCACCCGG + Exonic
1133131362 16:3677924-3677946 GGAGGCCTGTGGGTCACACCTGG + Intronic
1134306468 16:13037586-13037608 CCTAGCCTGGGAATCAAACCTGG + Intronic
1135272785 16:21083777-21083799 CCAGGCCTGGGGCTGTCCCCAGG + Intronic
1135830471 16:25768471-25768493 TCAGGGCAGGGGATCTCACCAGG + Intronic
1136704916 16:32179174-32179196 ACAGGCCTGGGGACCCAACCTGG - Intergenic
1136762998 16:32750233-32750255 ACAGGCCTGGGGACCCAACCTGG + Intergenic
1136805102 16:33120153-33120175 ACAGGCCTGGGGACCCAACCTGG - Intergenic
1137780795 16:51096152-51096174 CCGTTCCTGGGGTTCACACCTGG + Intergenic
1138026214 16:53524217-53524239 GCAGGCCTGGGAATCACACCTGG + Intergenic
1139538812 16:67598171-67598193 CCAGGCCTGGGCAACACAGTAGG - Intronic
1141621706 16:85239728-85239750 CCAGGGTTGGGGGTCCCACCGGG + Intergenic
1141655421 16:85413406-85413428 CCATGCTTGGGGGTCACAGCTGG - Intergenic
1141735651 16:85850693-85850715 GAAGGCCTGGGGACCAGACCTGG + Intergenic
1203065150 16_KI270728v1_random:1010555-1010577 ACAGGCCTGGGGACCCAACCTGG + Intergenic
1143053091 17:4142820-4142842 CGAGGGCTGGGGCCCACACCAGG - Exonic
1143066743 17:4255480-4255502 CGAGGCCAGGGGATCACCTCAGG - Intronic
1143197775 17:5089272-5089294 CTAGGACTGGGGATCACAGCTGG - Intronic
1144786969 17:17837283-17837305 CCAGGCCTGGGGCTTCCACTCGG - Intergenic
1144927489 17:18824758-18824780 ACAGGTCTGGGCAGCACACCTGG - Intergenic
1145874198 17:28304082-28304104 CCAGGCAGGGGGATCACCCAAGG + Intergenic
1146719493 17:35113754-35113776 CCTGGTCTGGGGACCACACTGGG - Intronic
1146816680 17:35947974-35947996 CCAGGCCGGTGGATCACATGAGG + Intergenic
1147037940 17:37695616-37695638 CAAGGCCTTGGGAGCCCACCTGG + Intronic
1147401168 17:40180838-40180860 CCAGTCCTGGTGAGGACACCTGG + Intronic
1150294423 17:64000187-64000209 CCAGCTCTGGGGGTCACACCTGG + Intronic
1150656659 17:67044167-67044189 CCAGGCCAGGGGAGGAGACCAGG - Intergenic
1151731707 17:75915174-75915196 CCCGCCCTGAGGATCACGCCTGG + Intronic
1152183638 17:78840685-78840707 GCAGGCCTGGGGACGAGACCGGG - Intronic
1152947513 17:83205964-83205986 CCAGGCCTGGGCATCTCCCCGGG + Intergenic
1154452957 18:14493881-14493903 CCAGGCATGTGGCTTACACCTGG + Intergenic
1157243891 18:46036779-46036801 GCAGGGCTGGGGAGCTCACCAGG + Intronic
1157277568 18:46322587-46322609 CCAGGGCTGGGAGGCACACCCGG + Intergenic
1158549891 18:58426817-58426839 CCAGGCCTGGAGGTCACAGCTGG - Intergenic
1160399190 18:78597342-78597364 ATGGGCCTTGGGATCACACCGGG - Intergenic
1160735996 19:662711-662733 CCGGGCTTAGGGATCCCACCTGG + Intronic
1160857954 19:1225885-1225907 CCAGGCCTGTGGGTTTCACCAGG + Intronic
1162036026 19:7940020-7940042 CCAGGGAGGGGGATCCCACCTGG - Intronic
1163035853 19:14568411-14568433 CCAGGCCTGGGGCTCAAGCGAGG - Intronic
1163417422 19:17195142-17195164 CCAGGCCTGGGGCTCCCACTGGG - Exonic
1164414229 19:28032898-28032920 CCAGGCCTGTGGGTCACACCAGG + Intergenic
1166133730 19:40762973-40762995 CCTGGCGGGGGGATCATACCAGG - Exonic
1166189638 19:41167516-41167538 CCAGGCTTTGGGCTCAAACCTGG - Intergenic
1166259469 19:41627553-41627575 CCAGGCCTGGGGGTCTCAGGAGG + Intronic
1166295916 19:41889316-41889338 CCAGGTCTAGGGAGCACAGCAGG + Intronic
1166298785 19:41902731-41902753 CCAGGCTTTGGGCTCACCCCAGG - Intronic
1166303056 19:41922887-41922909 CCAGGCCTGGGCATGGGACCCGG - Intronic
1166946899 19:46402923-46402945 CCAGGTCTCCGGGTCACACCAGG + Intergenic
1167033273 19:46977757-46977779 GCAGGGCTGGGATTCACACCCGG - Intronic
1167136289 19:47618118-47618140 ACAGGTTTGGGGGTCACACCTGG + Intronic
1167143013 19:47665130-47665152 CCTGGCTTGGGGAGCACAGCTGG - Intronic
1168703893 19:58457243-58457265 CCAGGCCAGGCCCTCACACCTGG - Exonic
925871731 2:8277763-8277785 CGTGGCCTGGGATTCACACCAGG - Intergenic
925975203 2:9137548-9137570 CCAGGCCTGGTGAGCTCTCCTGG + Intergenic
927181304 2:20448253-20448275 CCAGGCCTGTGCAACACAGCTGG - Exonic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
927504410 2:23603729-23603751 CCAGCCCTGGGGAGCAGGCCAGG + Intronic
927545788 2:23951691-23951713 CCAGGCAGGGGGATCACTTCAGG - Intronic
927918098 2:26949426-26949448 CCAGGCCTGGGAAAGCCACCAGG + Exonic
932012200 2:67989620-67989642 CCAGGACAGGGGATTAGACCAGG + Intergenic
933812152 2:86039563-86039585 AGAGGCCTGGGGATCTCACAGGG + Intronic
934774094 2:96926381-96926403 CCAGGCCTGCGCATCAGAGCAGG + Intronic
936485869 2:112925217-112925239 CTATGCCTCGTGATCACACCAGG - Intergenic
937476321 2:122218502-122218524 CCACACCTGGGGTTCACTCCAGG - Intergenic
938479032 2:131643799-131643821 CCAGGCATGAGGCTTACACCTGG - Intergenic
940129256 2:150362810-150362832 CCCTGCCTGGGAATCAAACCCGG - Intergenic
943781318 2:191827466-191827488 ACAGACCTGGGGATTACACAGGG - Intergenic
945946997 2:216004024-216004046 GCAGGCCTGGGGACCACTGCAGG - Intronic
946524741 2:220506459-220506481 GCAGGGCTGGGGCTCCCACCAGG - Intergenic
947528426 2:230893590-230893612 ACAGGCCTGGGGACTACCCCAGG - Intergenic
948189079 2:236044567-236044589 GCAGGCCTGGGGTTCACAAAGGG - Intronic
948517380 2:238512198-238512220 CCTGGCCTGGGGATGACTGCAGG - Intergenic
948574696 2:238942195-238942217 CCAGGCCTCCGGATCAGAGCCGG - Intergenic
948759236 2:240180188-240180210 CCAGGGGTGGGGATTACACAAGG - Intergenic
948991115 2:241554512-241554534 TCAGGCCTGGGTCTCATACCTGG - Intergenic
949037124 2:241821048-241821070 CCAGCCTGGGGCATCACACCTGG - Intergenic
1170705929 20:18744935-18744957 ACAGGCCTGGGGTGCCCACCTGG + Intronic
1171134527 20:22684653-22684675 GCAGGCCTGGGGATTCCACGAGG + Intergenic
1171231419 20:23489798-23489820 CCAGGCCTGGGCATCAGAGTGGG + Intergenic
1171293371 20:23995195-23995217 CCAGGACAGGGGAGCCCACCGGG + Intergenic
1173333652 20:42096233-42096255 CCAGGTCTGGGGATCAGTGCAGG - Intronic
1173561057 20:44006101-44006123 CCAGGCCTGGTGATCTTTCCAGG - Intronic
1173785715 20:45791707-45791729 CAAGGCCTGGGGATGACTGCGGG - Intronic
1173799655 20:45887005-45887027 CCAGGCCTGGGGCCCAGCCCTGG - Exonic
1174338841 20:49883493-49883515 CCAGGCCTGGCGCACACACAGGG + Intronic
1175088874 20:56485412-56485434 CAAGGCCTGGGGGCCACACTGGG + Intronic
1175941644 20:62540052-62540074 CCAGGAATGGGGTTCACATCAGG + Intergenic
1176156637 20:63625510-63625532 CCAAGCCTTGGGATCAAAGCTGG - Intronic
1176443081 21:6794402-6794424 CCAGGCATGTGGCTTACACCTGG - Intergenic
1176821246 21:13659447-13659469 CCAGGCATGTGGCTTACACCTGG - Intergenic
1178243479 21:30929317-30929339 CCAAGGCTGTGGATCACCCCAGG + Intergenic
1178406269 21:32325715-32325737 AGAGGCCTGGGGAACACAACTGG + Intronic
1179781207 21:43702196-43702218 CCAGGCCTGGGGCCCACACCTGG + Intergenic
1180005066 21:45016855-45016877 CCAGCCCAGGGCCTCACACCTGG - Intergenic
1180135560 21:45859786-45859808 CCAGGCCTGGTCTCCACACCCGG + Intronic
1180480167 22:15746278-15746300 CCAGGCGTGAGGCTTACACCTGG - Intergenic
1180636193 22:17264769-17264791 CCGGGCCGGGGGATCATGCCAGG + Intergenic
1180940924 22:19659119-19659141 CCAGGCCTCGGGTGGACACCAGG + Intergenic
1182898248 22:33876193-33876215 CCAGGCCTGGGGTTCTAACCTGG - Intronic
1183163704 22:36132016-36132038 CCAGGCCTGCGTTTCACCCCAGG - Intergenic
1183421363 22:37713493-37713515 CCAGGGCTGAGCCTCACACCAGG + Intronic
1183493344 22:38128206-38128228 CCAGGCCCCTGGATCACAGCAGG - Intronic
1183973955 22:41499384-41499406 CCAGCTCTGGTGATCACACGGGG - Intronic
1184401428 22:44276812-44276834 CCACCCCTGGGGACCCCACCCGG - Intronic
1184427750 22:44423200-44423222 CCAGGCCTGGGGAACGCTGCAGG - Intergenic
1184921475 22:47608609-47608631 CCAGGGCTGGAGAGAACACCAGG + Intergenic
952420168 3:33123289-33123311 CCAACCCTGGGGATTACAACTGG - Intronic
952604240 3:35125070-35125092 CAAGGCCTGGGGATTACCTCAGG - Intergenic
953020783 3:39111878-39111900 CCAGGCCTGGGAAGCAGACTTGG - Intronic
953174783 3:40540955-40540977 CCAGGCGGGTGGATCACACGAGG - Intronic
953225061 3:41010825-41010847 CCAAGCCTGGGCAGCACAGCAGG - Intergenic
954455044 3:50593178-50593200 CCAGGCCTGAGGCTCCCATCGGG - Intergenic
954682223 3:52351877-52351899 CCAGGCAGGGGCATCCCACCAGG - Intronic
954710369 3:52502436-52502458 CCCGGCCTGGGGCTCACAGAGGG - Intronic
955409695 3:58647511-58647533 CCAGCCCTGGGGACCACTTCTGG + Intronic
955833059 3:63025387-63025409 CCAGGCCTGTTGCTCATACCTGG - Intergenic
958978922 3:100697896-100697918 CCAGGCCTGCGGCTGAAACCAGG + Intergenic
961650507 3:128414497-128414519 CCAGAGCTGGGGCTCAGACCAGG + Intergenic
966112023 3:176414666-176414688 CAAGGCCTCGTGATCACACAAGG + Intergenic
966776626 3:183548294-183548316 CCAACCCTGGGAATCACAGCAGG - Intronic
966871453 3:184292585-184292607 CCAGGCCTGTGGGTCACAGTGGG - Exonic
967194924 3:187017798-187017820 CCAGGGCTGGGGATCGCGCCAGG - Intronic
968703739 4:2068852-2068874 CCAGGCTTGGGGAGCACAGGGGG + Exonic
968704656 4:2072313-2072335 CCAGGCGTGGGGCTCACCTCTGG - Intronic
969213890 4:5708320-5708342 CCCGGCCTGAGGATCCCTCCGGG - Exonic
969308762 4:6340178-6340200 CCGGGCCTGGGGGCCACAGCTGG - Intronic
969525539 4:7702202-7702224 CCAGGCCTGTGGCCCACAGCAGG - Intronic
969606891 4:8206323-8206345 CTGGGCCTGGGGAGCCCACCTGG + Intronic
970262706 4:14245222-14245244 ACAGTCCTGGGGATTACACAGGG - Intergenic
971608193 4:28685786-28685808 CCAGGGCTGGAGATGGCACCAGG + Intergenic
973330609 4:48907163-48907185 GCAGGCCTGGGGTTGACTCCAGG - Intergenic
973748062 4:53984101-53984123 CCAGGCATGAGGTTCACAGCAGG + Intronic
975116442 4:70686178-70686200 CCCAGCCTGGGGAACACAGCAGG + Intronic
977766193 4:100800373-100800395 CCAGGCCAGGGAAGCACACCTGG - Intronic
978806515 4:112806551-112806573 ACAGGCATGGGCACCACACCTGG - Intergenic
981269575 4:142829393-142829415 CCAGTCCTGGGGACCTCACAGGG - Intronic
986865548 5:11982159-11982181 CCAAGCATGGAGATCACAGCGGG - Intergenic
989212694 5:38871966-38871988 CCAGGTTTGGGAATCAGACCAGG - Intronic
989676589 5:43981059-43981081 CCATGCCTGGAGATGTCACCTGG + Intergenic
990820903 5:59839237-59839259 ACAGGCCTGGGGAAAACCCCAGG + Intronic
992472804 5:77075097-77075119 CCAGGCCCGGGGAGAACACTCGG + Exonic
992883545 5:81134469-81134491 ACAGGCCCAGAGATCACACCTGG - Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995014122 5:107290682-107290704 GCAGGCTTTGGGCTCACACCAGG + Intergenic
996794052 5:127324938-127324960 CCAGCCCTCAGCATCACACCTGG - Intronic
997698155 5:135877853-135877875 CCAGGCCTGGGAAGCACTCCAGG + Intronic
998133500 5:139662762-139662784 ACAGGCCTGGGCTCCACACCTGG + Intronic
999393580 5:151212204-151212226 CCAGGCCTGGGGTTGAGGCCAGG + Intronic
999418999 5:151424633-151424655 CTAGGCCAGAGGATCATACCTGG - Intergenic
1000199013 5:158989063-158989085 CCAGGCCTCTGGGGCACACCAGG + Intronic
1001593211 5:172880600-172880622 ACAGGCGTGGGCACCACACCTGG + Intronic
1001981865 5:176043636-176043658 CCAGGCCTCAGCAGCACACCAGG - Intergenic
1002235600 5:177800421-177800443 CCAGGCCTCAGCAGCACACCAGG + Intergenic
1002428042 5:179187277-179187299 CCTGGCCTGGAGGTCACGCCAGG - Intronic
1002617324 5:180464016-180464038 GCAGGCCTGGTCCTCACACCAGG - Intergenic
1002741406 5:181437718-181437740 CCAGGCCTGGGCATCTCCCCGGG + Intergenic
1003096127 6:3144902-3144924 CCAGGCCTGAGGGCCAGACCCGG + Intronic
1003402897 6:5805580-5805602 CCAGGACTGGGGATTACATTTGG - Intergenic
1003516527 6:6823201-6823223 CAAGTCCTGGAAATCACACCTGG + Intergenic
1005972792 6:30774639-30774661 CCAGGCCTGGGGATCTTCCTGGG + Intergenic
1006012050 6:31051004-31051026 CCAGGCCTGGGGATCACCTGAGG + Intergenic
1006434644 6:34019887-34019909 CCAGGGCTGGGGCCCACAGCTGG - Intronic
1006580542 6:35074702-35074724 CGAGGCCTGGGCACCACTCCAGG - Intronic
1006627381 6:35406945-35406967 ACAGGCCTGAGGATCCCAACAGG - Intronic
1007269438 6:40624892-40624914 CCAGCCCTGGGGACCAGGCCTGG - Intergenic
1011044807 6:83069149-83069171 CGAAGCCTGGAGATCACACCTGG - Intronic
1013286797 6:108689128-108689150 CCAGGCTTAGGAATCAGACCAGG + Intergenic
1015626094 6:135181847-135181869 CCAGCCCCGGGGAGCCCACCAGG + Intronic
1016107209 6:140177706-140177728 CCAGGCGTGCGGATCACCCAAGG - Intergenic
1018655712 6:166033920-166033942 CCAGGCCTGGGGAACAAAGGAGG + Intergenic
1019246540 6:170713483-170713505 CCAGGCCTGGGCATCTCCCCGGG + Intergenic
1019531393 7:1505224-1505246 ACAGGCATGAGCATCACACCTGG - Intergenic
1019584122 7:1787461-1787483 CCAAGCCTGGGGACCACACTGGG - Intergenic
1019735095 7:2646641-2646663 CCAGGCCTGGACCCCACACCTGG - Intronic
1020097330 7:5376399-5376421 CCGGGCCTGGGGTGCACACGTGG - Intronic
1022103229 7:27181336-27181358 GCCGGCCTGGGGATCTCATCTGG - Intergenic
1022370924 7:29770593-29770615 CCAGGCGTGGGCAGCCCACCTGG - Intergenic
1022650335 7:32268072-32268094 CCAGCCATGCGGGTCACACCAGG + Intronic
1023185683 7:37530594-37530616 GCAGGCCCAAGGATCACACCTGG + Intergenic
1023965742 7:44962359-44962381 GCAGGGCTGGGGAGCACGCCTGG - Intergenic
1023984665 7:45087843-45087865 CCTGCCCTGGGGGCCACACCAGG - Intronic
1024043923 7:45574810-45574832 CCTGGCCAAGGGCTCACACCCGG + Exonic
1026118104 7:67513379-67513401 CAAGGGCAGGGGATCACACGTGG - Intergenic
1027055268 7:75045454-75045476 CCAGGCCTGGGGATCACACCTGG - Intronic
1029366579 7:100120216-100120238 CAAGGCCTGAGCCTCACACCCGG - Intronic
1029457313 7:100677797-100677819 CCAGCTCTGGGGATACCACCTGG + Exonic
1030875754 7:114811161-114811183 CCAGGCCTTGGCTCCACACCTGG - Intergenic
1032010397 7:128343215-128343237 CCAGGTCTGAGGATCAAATCGGG + Intronic
1032077835 7:128844444-128844466 CCTGGCCTTGGAGTCACACCTGG + Intronic
1032581205 7:133105156-133105178 CCAGGGCTGGGGATCAGGCTGGG - Intergenic
1035447156 7:158950957-158950979 CCAGGCACGGTGCTCACACCTGG - Intronic
1035501599 8:94478-94500 CCAGGCCTGGGCATCTCCCCGGG - Intergenic
1038362708 8:26898445-26898467 CCAGGGATGGGGATCTCAGCAGG + Intergenic
1038372859 8:27011080-27011102 CCAGGCGGGCGGATCACACTTGG - Intergenic
1038797702 8:30724470-30724492 CCAGGCCTAGGCATCAAAACGGG - Intronic
1039480694 8:37871333-37871355 CCAGGCCTGGGTCTCACCCTCGG - Exonic
1039548375 8:38426054-38426076 CCAGGCTTGGAGAACACAGCCGG - Intronic
1039621073 8:38997251-38997273 CCCGGCCTGGGGATCGGACCCGG + Intronic
1042690215 8:71489998-71490020 CCAGTCCTGGAGATCACACTTGG - Intronic
1042848041 8:73187796-73187818 GCAGGCCTGAGGAGGACACCTGG + Intergenic
1046292528 8:112181539-112181561 CCAGGCAGGTGGATCACATCAGG + Intergenic
1048925051 8:139264173-139264195 CCAGGGCTGGGACCCACACCTGG + Intergenic
1049600829 8:143506821-143506843 CCAGGCCTGAGGCTAACCCCAGG - Intronic
1051207353 9:14702270-14702292 CCAGGCCTGGGGATGATTTCTGG - Intergenic
1051735802 9:20198107-20198129 CAATCCCTGGGGATCACATCTGG - Intergenic
1052972774 9:34387151-34387173 CCAGGCATGTGCACCACACCTGG + Intronic
1053424018 9:37999215-37999237 CCAGGCCTGGGAAACTCATCAGG + Intronic
1056913127 9:90721066-90721088 CCAGGCATGGGGATGACATCTGG - Intergenic
1057125296 9:92611607-92611629 CCAGTCCTGGGGCCCACCCCAGG + Intronic
1057931474 9:99197295-99197317 CCAGGCCTGGGCTGAACACCAGG + Intergenic
1059224635 9:112660158-112660180 CCAGACCGGGAGGTCACACCTGG - Exonic
1059433056 9:114261239-114261261 CCAGGCCTGGGGATCAGGCTTGG - Intronic
1060220799 9:121763149-121763171 CCTGGCCTGGTGACCACAGCAGG - Intronic
1060279181 9:122204605-122204627 CCAGGCCTCGGGAACCGACCTGG + Exonic
1060396912 9:123322735-123322757 TCAGGCCTGCAGATCACTCCTGG + Intergenic
1060874964 9:127076732-127076754 CCAGTGCTGGTGATCACAACTGG - Intronic
1061146966 9:128805728-128805750 CCAGCCCTGGTGCTCACACCTGG + Intronic
1061275143 9:129565834-129565856 CCAGGTCTGAAGAGCACACCTGG - Intergenic
1061545847 9:131303873-131303895 CCAGGGCTGGAGCTCACAGCTGG + Intronic
1061656691 9:132097422-132097444 CTAGGCCTAGGGAACACAGCGGG + Intergenic
1061930948 9:133832914-133832936 CCAGGCCTGGGGCGCCCACCTGG - Intronic
1062546127 9:137064491-137064513 GCAGGCCTGGGGAGCCCATCTGG + Exonic
1062658137 9:137614646-137614668 CCAGGCCTGGGGCTGCCTCCTGG + Exonic
1203526121 Un_GL000213v1:90129-90151 CCAGGCATGTGGCTTACACCTGG + Intergenic
1203607317 Un_KI270748v1:68934-68956 CCAGGCCTGGGCATCTCCCCGGG + Intergenic
1186171292 X:6879830-6879852 CCTGCCCTGGGTTTCACACCTGG + Intergenic
1186213714 X:7276967-7276989 CCAGGATGGGGGATTACACCTGG + Intronic
1186781935 X:12921451-12921473 CCAGTCCTGGGGATCAAAGAGGG + Exonic
1187310136 X:18133932-18133954 CCAGGCCTGGCCCTCACTCCTGG + Intergenic
1191106001 X:56772762-56772784 CCAGGCCTTGGGAGGACCCCCGG + Intergenic
1191106994 X:56778164-56778186 CCAGGCCTTGGGAGGACCCCCGG + Intergenic
1193082864 X:77422913-77422935 CCAGGCTTGGAGATCAGACCTGG - Intergenic
1193125360 X:77864942-77864964 CAAGGCGTGGGGATCACTTCAGG - Intronic
1195468915 X:105211449-105211471 ACAGGCCTGGGGTTAACCCCAGG - Intronic
1195616775 X:106918615-106918637 CAAGGCCTGGGTACCAAACCTGG - Intronic
1195992168 X:110693567-110693589 CGAGGCCAGGGGTTCAAACCAGG - Intronic
1199672672 X:150160126-150160148 CCAGGCCTTGGAATCACAGTTGG + Intergenic
1200101403 X:153690577-153690599 CCAGGCCTGGTGCTCACGACAGG - Intronic
1200152270 X:153957042-153957064 CCAGGACTGCTGGTCACACCTGG + Exonic
1202368710 Y:24183295-24183317 CCCCGCCTGTGGATGACACCTGG - Intergenic
1202502075 Y:25486822-25486844 CCCCGCCTGTGGATGACACCTGG + Intergenic