ID: 1027061681

View in Genome Browser
Species Human (GRCh38)
Location 7:75091618-75091640
Sequence CTATGTGTGTTGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027061681_1027061686 28 Left 1027061681 7:75091618-75091640 CCATCTCCCCTCAACACACATAG No data
Right 1027061686 7:75091669-75091691 AGAGAGAAAGTGGTAGAATCTGG No data
1027061681_1027061687 29 Left 1027061681 7:75091618-75091640 CCATCTCCCCTCAACACACATAG No data
Right 1027061687 7:75091670-75091692 GAGAGAAAGTGGTAGAATCTGGG No data
1027061681_1027061685 18 Left 1027061681 7:75091618-75091640 CCATCTCCCCTCAACACACATAG No data
Right 1027061685 7:75091659-75091681 AAAAAAAGAGAGAGAGAAAGTGG 0: 12
1: 192
2: 1077
3: 4805
4: 17494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027061681 Original CRISPR CTATGTGTGTTGAGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr