ID: 1027081915

View in Genome Browser
Species Human (GRCh38)
Location 7:75236877-75236899
Sequence CCGGCCCAACCGAGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027081906_1027081915 -5 Left 1027081906 7:75236859-75236881 CCCGCCGTGGCGACGGGGCCGGC No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081902_1027081915 -2 Left 1027081902 7:75236856-75236878 CCCCCCGCCGTGGCGACGGGGCC No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081897_1027081915 2 Left 1027081897 7:75236852-75236874 CCCTCCCCCCGCCGTGGCGACGG No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081903_1027081915 -3 Left 1027081903 7:75236857-75236879 CCCCCGCCGTGGCGACGGGGCCG No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081907_1027081915 -6 Left 1027081907 7:75236860-75236882 CCGCCGTGGCGACGGGGCCGGCC No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081899_1027081915 1 Left 1027081899 7:75236853-75236875 CCTCCCCCCGCCGTGGCGACGGG No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081908_1027081915 -9 Left 1027081908 7:75236863-75236885 CCGTGGCGACGGGGCCGGCCCAA No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081904_1027081915 -4 Left 1027081904 7:75236858-75236880 CCCCGCCGTGGCGACGGGGCCGG No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data
1027081895_1027081915 18 Left 1027081895 7:75236836-75236858 CCGCGCTCAGCGGAATCCCTCCC No data
Right 1027081915 7:75236877-75236899 CCGGCCCAACCGAGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027081915 Original CRISPR CCGGCCCAACCGAGGGATGG GGG Intergenic