ID: 1027082548

View in Genome Browser
Species Human (GRCh38)
Location 7:75239885-75239907
Sequence CCCAAACAGAAATGCATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027082543_1027082548 13 Left 1027082543 7:75239849-75239871 CCTATCTATGCCTTTAGAATCTA No data
Right 1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG No data
1027082544_1027082548 3 Left 1027082544 7:75239859-75239881 CCTTTAGAATCTAGAGATCCAGA No data
Right 1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027082548 Original CRISPR CCCAAACAGAAATGCATTCA GGG Intergenic
No off target data available for this crispr