ID: 1027086988

View in Genome Browser
Species Human (GRCh38)
Location 7:75271455-75271477
Sequence CACCCTATAGAGTTGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027086980_1027086988 16 Left 1027086980 7:75271416-75271438 CCCTCATTTTCCTTCTCTGTTAA No data
Right 1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG No data
1027086984_1027086988 6 Left 1027086984 7:75271426-75271448 CCTTCTCTGTTAATATGGGTGAT No data
Right 1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG No data
1027086981_1027086988 15 Left 1027086981 7:75271417-75271439 CCTCATTTTCCTTCTCTGTTAAT No data
Right 1027086988 7:75271455-75271477 CACCCTATAGAGTTGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027086988 Original CRISPR CACCCTATAGAGTTGTTGGA AGG Intergenic
No off target data available for this crispr