ID: 1027105626

View in Genome Browser
Species Human (GRCh38)
Location 7:75403524-75403546
Sequence GTTCCCGCCCTGGTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027105623_1027105626 -9 Left 1027105623 7:75403510-75403532 CCTGGGTGGCTCTGGTTCCCGCC 0: 3
1: 0
2: 1
3: 24
4: 182
Right 1027105626 7:75403524-75403546 GTTCCCGCCCTGGTTTCCCTGGG 0: 3
1: 0
2: 1
3: 5
4: 128
1027105618_1027105626 12 Left 1027105618 7:75403489-75403511 CCTGTTTTGGACTCAAGGGTACC 0: 3
1: 0
2: 0
3: 3
4: 70
Right 1027105626 7:75403524-75403546 GTTCCCGCCCTGGTTTCCCTGGG 0: 3
1: 0
2: 1
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027105626 Original CRISPR GTTCCCGCCCTGGTTTCCCT GGG Intronic