ID: 1027107420

View in Genome Browser
Species Human (GRCh38)
Location 7:75414147-75414169
Sequence GAGCCCAGTGGAGGAGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027107420_1027107425 2 Left 1027107420 7:75414147-75414169 CCCGTGCCTCCTCCACTGGGCTC No data
Right 1027107425 7:75414172-75414194 ACCTGTCTTATTTTGTCCTTTGG No data
1027107420_1027107427 5 Left 1027107420 7:75414147-75414169 CCCGTGCCTCCTCCACTGGGCTC No data
Right 1027107427 7:75414175-75414197 TGTCTTATTTTGTCCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027107420 Original CRISPR GAGCCCAGTGGAGGAGGCAC GGG (reversed) Intergenic
No off target data available for this crispr