ID: 1027108168

View in Genome Browser
Species Human (GRCh38)
Location 7:75418587-75418609
Sequence AAGGGGAAGCAGGATGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 3, 1: 0, 2: 0, 3: 41, 4: 573}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027108168_1027108185 20 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108185 7:75418630-75418652 CCAGAAGGGAAAGGGCCCCAGGG 0: 3
1: 0
2: 2
3: 41
4: 279
1027108168_1027108180 11 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108180 7:75418621-75418643 GTGCTTCCTCCAGAAGGGAAAGG 0: 3
1: 0
2: 4
3: 21
4: 261
1027108168_1027108178 5 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108178 7:75418615-75418637 AGGCTTGTGCTTCCTCCAGAAGG 0: 3
1: 0
2: 2
3: 21
4: 166
1027108168_1027108183 19 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108183 7:75418629-75418651 TCCAGAAGGGAAAGGGCCCCAGG 0: 3
1: 0
2: 1
3: 25
4: 258
1027108168_1027108181 12 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108181 7:75418622-75418644 TGCTTCCTCCAGAAGGGAAAGGG 0: 3
1: 0
2: 4
3: 30
4: 295
1027108168_1027108179 6 Left 1027108168 7:75418587-75418609 CCCTCCGCATCCTGCTTCCCCTT 0: 3
1: 0
2: 0
3: 41
4: 573
Right 1027108179 7:75418616-75418638 GGCTTGTGCTTCCTCCAGAAGGG 0: 3
1: 0
2: 3
3: 20
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027108168 Original CRISPR AAGGGGAAGCAGGATGCGGA GGG (reversed) Exonic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900763460 1:4488234-4488256 AAGGGGAAGGAGGAAGCCAAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
902208452 1:14887153-14887175 AAGGGGAAGCAGGAAGGAAATGG - Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903494223 1:23754016-23754038 AAAGGGAAGTAGGAGGCTGAAGG + Intronic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
904008998 1:27379454-27379476 AGGGGAAAGGAGGATGCAGAGGG - Exonic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG + Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905256471 1:36688566-36688588 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256492 1:36688620-36688642 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256513 1:36688674-36688696 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256612 1:36688944-36688966 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256635 1:36689008-36689030 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
906745134 1:48216084-48216106 AATGGGAAGCTGGATGGGGCAGG + Intergenic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907223961 1:52927647-52927669 AAAGGGAAGGAGGAAGCAGAAGG - Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
908427160 1:64018282-64018304 AAGGAGAAGCAGGAAACTGAGGG - Intronic
909496681 1:76286593-76286615 AAGGGGAAGAAGGTTGCCCAAGG - Intronic
909927483 1:81455318-81455340 AAGAGGAGGCAGGATGCACAAGG + Intronic
910946690 1:92600476-92600498 AAGGGGAAACAGGCTGGGGCTGG + Intronic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916052990 1:161049095-161049117 GAGAGGCAGCAGGATGTGGAAGG - Exonic
916229842 1:162530866-162530888 AAAGGGAAGCTGGATCTGGAAGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916749238 1:167709336-167709358 TGAGGGAAGCAGGATGCCGAAGG + Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919850363 1:201668238-201668260 AGGGGGTGGCAGGAGGCGGAGGG - Intronic
920226640 1:204443814-204443836 AAGGAGAAACAAGATGCAGAGGG - Intronic
920298308 1:204973429-204973451 AGGGGGAAACAGGCTGCGAAGGG - Intronic
921050658 1:211509010-211509032 AAGGGCAAGGAGGATGAGAAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
922732703 1:227959541-227959563 AAGGTGCAGCAGGACCCGGAAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923072424 1:230577859-230577881 AAGGGGAAGAAGGAGGGGAAGGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1064619376 10:17199561-17199583 ACGGTGAAGCGGGATGCTGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068199188 10:53761050-53761072 AAGAGGAAGCAGGTTGGGGTGGG + Intergenic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1068564192 10:58553205-58553227 AAGGGGAATTAGGTTGCAGATGG + Intronic
1069718477 10:70535433-70535455 AGGGGGAAGGAGGAAGCGGGGGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070148542 10:73791826-73791848 AAGGGGCAGGAGGCTGCTGAGGG - Intronic
1070826875 10:79395990-79396012 AAGTGGGAGTAGGATGGGGAAGG - Intronic
1071152233 10:82649245-82649267 AAGGGGAGGCAGGAGGTAGAGGG - Intronic
1072030938 10:91521854-91521876 AAAGGGGAACAGGATGGGGAGGG - Intergenic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1073111193 10:101063868-101063890 AAGGGGAAGGGGGATCTGGAAGG + Intronic
1073537566 10:104291566-104291588 AAGGGGAAGGAGGAAGCGCGCGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597715 10:104817394-104817416 AAGGGGGAGGAGGAGGGGGAAGG - Intronic
1074571625 10:114629688-114629710 AAGGGTAAGTAGGTTGCTGAAGG - Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1075086097 10:119415386-119415408 AAGGGGAAGCAGGTCGGGCAGGG + Intronic
1075404863 10:122188009-122188031 AAAGGCAGGCAGGATGTGGAAGG - Intronic
1075679531 10:124322494-124322516 AAGGAACAGCAGGATGCTGAGGG - Intergenic
1076874870 10:133211051-133211073 AAGGGGAAGCACCAAGCAGAGGG + Intronic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1079124120 11:17706780-17706802 AAGGGGAAAAAAGATACGGAGGG + Intergenic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1081801876 11:45865674-45865696 GAGGGGCAGCAGGAGGCGGAGGG + Intronic
1081994520 11:47355047-47355069 GAGGCGAAGCGGGATGTGGAGGG + Exonic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083722143 11:64608719-64608741 AGGAGGAGGCAGGATGCGCAGGG - Intronic
1083876173 11:65525368-65525390 AAGGGGTAGCAGGCCGGGGAGGG + Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084934680 11:72580539-72580561 AAGGGGAAGAAGGACGGGGTGGG + Intronic
1085297240 11:75438109-75438131 AGGGGAAAGCAGGAGGCGGGGGG + Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088735332 11:112723744-112723766 AAGGGGAGGGAGGATGGGCAGGG + Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090331067 11:125932569-125932591 AAGGGGAAGCAGGCTTGGGCTGG - Intergenic
1090355501 11:126137831-126137853 GAGGTGAAACAGGATGCAGAGGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091035261 11:132227438-132227460 AAAGGGAAGCAGAATATGGAGGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092166821 12:6347726-6347748 GAGGGGAAGCAAGATGGGTAAGG - Exonic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1094555671 12:31497761-31497783 AAGGGGGAGCGGCATGGGGAGGG + Intronic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095965637 12:47865158-47865180 CAGGCGAAGCATGAAGCGGAAGG - Exonic
1096504110 12:52082017-52082039 CCGGGGAAGCAGGATGGGAAGGG - Intergenic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101877783 12:108607029-108607051 AAGGGGAGGAAGGGAGCGGAGGG - Intergenic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102599407 12:114017822-114017844 GAGGGGAAGCAGGATAGGAAAGG - Intergenic
1102642479 12:114379230-114379252 AAGGGGAAGCAGGAAGCACCAGG - Intronic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1103282518 12:119771689-119771711 AAGGAGAAGCTGGAGGCAGATGG + Intronic
1103458780 12:121087639-121087661 AAAGGGAAGCAGGGGGCTGACGG - Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1108396682 13:49996997-49997019 AAGGGGAAGCGGGAGAGGGAAGG + Intronic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1110530400 13:76590690-76590712 AAGGAGAAGCAGGAGGCTAAGGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1112416426 13:99206882-99206904 GAGAGGGAGCAGGAAGCGGAAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114742532 14:25112771-25112793 AAAGGGAAAAAGGATGTGGAAGG - Intergenic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1116913587 14:50498012-50498034 AAGGGAAAGTAGGATTCTGATGG + Intronic
1117339128 14:54778881-54778903 AAGGGGAAGGAGGCTGCAGAAGG + Intronic
1117919038 14:60708451-60708473 AAGAGGCAGAAGGAGGCGGAAGG - Intergenic
1118446268 14:65853812-65853834 AAGGGGCAGCAGGGAGGGGAGGG + Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119707053 14:76789473-76789495 AAGGGGATGCAGCCTGCAGAAGG - Intronic
1119714015 14:76845367-76845389 AAGGGGAAGAGGGAGGGGGAGGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1121842702 14:97147711-97147733 AAGTGGAAGTGGGAGGCGGAAGG - Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122687178 14:103514900-103514922 GAGGGGAAGAGGGATGCAGAAGG + Intergenic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123508061 15:20965737-20965759 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123565280 15:21539478-21539500 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123601543 15:21976762-21976784 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123772060 15:23538879-23538901 AATGGGCAGCTGGATGTGGAAGG - Intergenic
1124612235 15:31216219-31216241 GAGGGGAAGGGGGAGGCGGAGGG + Intergenic
1124816778 15:33001690-33001712 AGGGGGAAGGGGGAGGCGGAAGG - Intronic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126572122 15:50163853-50163875 AAGGGGAAGGAAGAAGGGGAAGG - Intronic
1127122051 15:55780297-55780319 AAGAGGAAGGAGGAAGCAGAAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128791021 15:70434064-70434086 AAGGCGAAGGAGGATGCCGTGGG - Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131905359 15:97136336-97136358 AAGGGGAAGCAGGACGTACATGG + Intergenic
1202973651 15_KI270727v1_random:266585-266607 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133110217 16:3543555-3543577 AAGGGAACGGAGTATGCGGAGGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134894963 16:17877478-17877500 AAGTGCACGCAGGATGGGGAGGG - Intergenic
1135259425 16:20968033-20968055 AATGGGAAGCAGGAGCCAGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135622560 16:23968397-23968419 AAGAGGAAGAAGCAAGCGGAGGG + Intronic
1135823649 16:25706737-25706759 AAGGGGAATTAGGTTGCAGATGG + Intronic
1136081345 16:27854325-27854347 AAGGGGGAGGAGGAGGGGGACGG + Intronic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1136540758 16:30926567-30926589 AGGGGGACGCAGGATGCAGCTGG - Intronic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1137921963 16:52498762-52498784 ACGGGGAAGCAGGATATGCACGG - Intronic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140151940 16:72376302-72376324 AAGGAGAAGCAGGGTGCTAAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141896055 16:86959371-86959393 AAGGGGAAGATGGATGGGGCTGG + Intergenic
1142201950 16:88765310-88765332 AAGGGGAAGCAAGGTTCTGAAGG - Intronic
1142215034 16:88825893-88825915 AACGGGAAGCAAGGTGGGGACGG - Intronic
1142601213 17:1053795-1053817 AACGGGAAGCAGGAGAGGGAGGG + Intronic
1143096489 17:4481058-4481080 GAGGGGAAGCAGGACACCGAGGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1143875657 17:9988785-9988807 AAGGGGATGCCAGATGTGGAGGG - Intronic
1144409943 17:14991165-14991187 AAGGGGATGTGGGATGCTGAAGG + Intergenic
1144410252 17:14993916-14993938 GAGGGGATTCAGGATGCTGAAGG + Intergenic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1144835783 17:18156036-18156058 GAGGGGAAGCAGGAAGCTTAGGG + Intronic
1145264943 17:21375415-21375437 AAGGGGAAGCTGGAGGCCAAGGG + Intergenic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1148046452 17:44747919-44747941 AAGGGGAAGCAGGGCTCAGAGGG - Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148648182 17:49230944-49230966 AAAGGGTAGCAGGGTGGGGATGG + Intergenic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148775920 17:50095697-50095719 ATGGGGAAGCAGGAACCGGCCGG + Intronic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152377987 17:79928515-79928537 AAGAGGGAGCAGGCTGGGGAAGG - Intergenic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1156563407 18:38155993-38156015 AAAGGGTAGCTGGATGCTGATGG - Intergenic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1158646731 18:59254964-59254986 GAGGGGGAGCGGGAGGCGGAGGG - Intergenic
1158901689 18:61967882-61967904 AAGGGGAAGAAAGCTTCGGATGG + Intergenic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161657172 19:5523421-5523443 AAGGGGAGGCAGGGAGGGGACGG - Intergenic
1162376023 19:10305745-10305767 ATGGGGAAGCAAGATGGAGAAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163595994 19:18221207-18221229 AAGGAGAGGCCGGATCCGGAGGG + Intronic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1164340187 19:24386866-24386888 AAGGGGAAGGAGTATACGGTAGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165119845 19:33552021-33552043 AAGGGGAACCTGGATGCTGCTGG + Intergenic
1165549960 19:36575467-36575489 AGGGGCAAGCAGGAGGCGGGGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166379962 19:42350693-42350715 AAGAGGAAGCAGGGTGTCGAGGG - Intronic
1166499729 19:43331604-43331626 AAGGGGAAGCAGGAACCAGAAGG - Intergenic
1166944697 19:46389854-46389876 GAGGGGCAGGAGGATGGGGATGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167240840 19:48342206-48342228 AAGGGGAAGAAGGAAGGGAAGGG + Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167418652 19:49390234-49390256 AAGCCGAAGCAGGATGCAGGAGG + Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167686528 19:50960082-50960104 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167686544 19:50960118-50960140 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927212389 2:20646775-20646797 AAGGTGAGGCTGGATGCTGAGGG + Intronic
927973902 2:27323297-27323319 AAGGGGCAGGAGGAGGCAGAGGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
929011508 2:37449839-37449861 AAGGGGAGGCAGGGCGTGGATGG - Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931671718 2:64653832-64653854 AGGAGGAAGCAGGAGGCGGGCGG + Exonic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932752224 2:74378680-74378702 AAGGGGAAACAGGATTCTGTAGG - Intronic
932891259 2:75598935-75598957 AAGGGCAAGAATGATGTGGAAGG - Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938101028 2:128498348-128498370 GAGGGCATGCAGGCTGCGGAGGG + Intergenic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940945697 2:159615620-159615642 AAAGGGCAGCAGGAGGCGGACGG + Intronic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
944100374 2:196019937-196019959 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
945230973 2:207589481-207589503 AAGGGGAATTAGGTTGCAGATGG - Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947511011 2:230754397-230754419 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
947511024 2:230754433-230754455 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1170416395 20:16147439-16147461 AATGGGCAGCAGGAAGCAGATGG - Intergenic
1170429797 20:16265534-16265556 AAGTTGCAGCAGGATGCGGGTGG - Intergenic
1170699998 20:18695417-18695439 AAGGGGAAGGGGGAGGCGGAGGG - Intronic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172851718 20:37971156-37971178 AAGGGTAACTAGGATGTGGAAGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173153632 20:40588990-40589012 AAGGGGAATTAGGTTGCCGATGG - Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1174707054 20:52667691-52667713 AAGTGGAAGAAGGATGGGAAAGG - Intergenic
1175873272 20:62218259-62218281 ACGGGGAATCTGGATGCAGATGG - Intronic
1176077373 20:63254545-63254567 AGGGGGGAACGGGATGCGGAGGG - Intronic
1176161282 20:63650207-63650229 AAGGGGAAGGATGGTGGGGAGGG - Intronic
1176367536 21:6043069-6043091 AAGGGGAAGAATGATGGAGACGG - Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178389158 21:32184601-32184623 AAAGGGATGCAGGAAGCCGAAGG - Intergenic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1179755983 21:43495473-43495495 AAGGGGAAGAATGATGGAGACGG + Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182706373 22:32283133-32283155 AAGGGGTTGCAGAATGCAGAAGG - Intergenic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183425783 22:37738761-37738783 AGGGGGAAGCAGGTTGGAGATGG + Intronic
1183496504 22:38147975-38147997 ATAGGGAAGGAGGAGGCGGAAGG + Intronic
1183806279 22:40213975-40213997 AAGGGGTAGCAGGCTGGGCACGG + Intronic
1184075728 22:42176295-42176317 AAGGGCAAGAAGGATGTGAAAGG + Intronic
1184092484 22:42299829-42299851 AAGGGGGAGAAGGAAGCGGAGGG + Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1185384648 22:50526200-50526222 AAGGGGATGGCGGAGGCGGAAGG + Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
950076878 3:10193714-10193736 AAGGGGACGCAGGTGACGGAAGG - Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
952892458 3:38052774-38052796 GAGGGGGAGGAGGAGGCGGAGGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953385882 3:42505426-42505448 CAGGGGCAGCAGGATGCCGGTGG - Intronic
953481370 3:43255185-43255207 AACGGGAAGCAGGCTGGGGCAGG - Intergenic
953881729 3:46694412-46694434 AGGGGGAATCAGGCTGCTGACGG - Intergenic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
954139252 3:48596431-48596453 AAGGGGGAGCAGGACCCAGATGG - Intergenic
954360973 3:50122696-50122718 AAGGGGACGGAGGAGGCTGAGGG + Intergenic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
957523038 3:81345570-81345592 AAGGGGAAGGTGGATGGAGATGG + Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961175228 3:124829939-124829961 AAGGGGAAGCAGGAATGAGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
962284597 3:134075528-134075550 AAGGGCCAGCAGGATGCTGATGG - Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
969352877 4:6608299-6608321 AAAGGGAGGCAGGCTGTGGAGGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
970486150 4:16526614-16526636 AAGTGGAAGAAGGATTCAGAAGG + Intronic
970633394 4:17979788-17979810 AGGGGGAAACAGGCTGCAGATGG + Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972295381 4:37732774-37732796 TAGGGGAAACAGGATGTGTATGG + Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
974411241 4:61543317-61543339 AAGTGGAAGCAGGAGGCAAAGGG + Intronic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978925554 4:114238527-114238549 AAGGTGAAGAAGGATGCACATGG - Intergenic
980117657 4:128695206-128695228 AAGGGGAAGCACGTGGCAGAAGG + Intergenic
982017362 4:151168260-151168282 GAAGGGAAGCAGGTTGCAGAAGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG + Intergenic
985553655 5:545763-545785 AAGGGGCACCAGGATGCCTAAGG - Intergenic
986156049 5:5177019-5177041 AAGGAGAAGCAGGACTGGGAAGG - Intronic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987295847 5:16550602-16550624 AAGGGGAAGAAGCATGCAGCAGG - Intronic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
988412731 5:30908179-30908201 AAGGGTAAGAAGGATGGGAATGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990450756 5:55929808-55929830 AAGGAGAAGCATCCTGCGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
992153553 5:73930952-73930974 AAGGGGAAGCATGAGACTGAGGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993272653 5:85815004-85815026 AAGGGGAAGTATGGTGTGGAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
996087348 5:119318666-119318688 AGGGGGCAGGAGGATGCGGGGGG - Intronic
996126648 5:119733224-119733246 AAGGGTAAGCAGGATACTTATGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000250804 5:159493072-159493094 AAGGGCAAGCAGGATGCTTGGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001086196 5:168701636-168701658 AAGGAGAAGCAGGAGCCAGAAGG - Intronic
1001196503 5:169677876-169677898 AAAGGGAAGCTGGATGTGGGAGG + Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002316919 5:178349571-178349593 AAGGTGAGGCAGGAAGCGGGAGG - Intronic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003595178 6:7468332-7468354 AACAGGAAGAAGGATGAGGATGG + Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004537397 6:16515807-16515829 AAGCGGATGCAGGAGGGGGATGG + Intronic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007410514 6:41658684-41658706 AAGGTGAAGCAGCAGGCTGAAGG + Intergenic
1009932653 6:70194393-70194415 AAGGGGCACCAGGATGTTGAAGG - Intronic
1009960566 6:70515827-70515849 GAGGGGAAGCTGGATGTGTAGGG + Intronic
1010029701 6:71260108-71260130 AAGGGTAAGCAGGATAGGGCAGG - Intergenic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013370967 6:109470657-109470679 AGTGGGAGGCAGGATGCTGAGGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019525243 7:1477759-1477781 GGGGGGAAGCCGGGTGCGGACGG - Exonic
1019721651 7:2575861-2575883 AAGGTGGAGAAGGAGGCGGATGG - Intronic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1022099651 7:27161562-27161584 AAGGGGAACCAGGGCGCGGGTGG - Intergenic
1023003735 7:35840173-35840195 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027544013 7:79503733-79503755 AAGGGGGAGGAGGAGGCGGAGGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031870086 7:127081619-127081641 AAGGGGAGGGAGGAGGCAGAGGG + Intronic
1031989821 7:128190175-128190197 GAGGGGAAGCAGGATTGGGCAGG + Intergenic
1032458832 7:132094357-132094379 AAGGGGAGGCTGGAGGCTGAGGG - Intergenic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033045967 7:137962444-137962466 AAGGGGAAGGAGGATGGTGCGGG - Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034241914 7:149617379-149617401 AAGGGACAGCAGGAGGCGGTTGG + Intergenic
1034367944 7:150568007-150568029 CAGGAGAAGCTGGATGCTGATGG + Intronic
1034477946 7:151298534-151298556 AAGGGGAAGAGGTATGCTGATGG + Intergenic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036453704 8:8891356-8891378 CAGGAGAAGCACGACGCGGAGGG - Exonic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1037674127 8:21039690-21039712 AAGGGAAAGATGGATGGGGATGG - Intergenic
1039467980 8:37797277-37797299 CGGGGGACGCAGGATGCGGGGGG + Exonic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042841831 8:73131785-73131807 AAGGGGAAGAAGGGGGGGGAAGG - Intergenic
1044953093 8:97452484-97452506 AATGGTCAGCAGGATGAGGATGG + Intergenic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047201766 8:122773190-122773212 AAGGGGTATAAGGATGTGGATGG + Intergenic
1047371122 8:124256937-124256959 AAGGGGAAGGAGGATGAGTCTGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048106222 8:131413201-131413223 AAAGGGAAGCAGGAGGCAGGAGG + Intergenic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048981051 8:139703565-139703587 AAGGGGAAGCAGGTTCCGCTGGG - Intergenic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049571160 8:143370887-143370909 AAGGGGGAGCAGGCTGCAGAGGG + Intronic
1049582154 8:143417673-143417695 AAAGGAAAGCAGGATGGAGATGG - Intergenic
1050495273 9:6234415-6234437 GAGGGGAAGCAGGGTGGTGAAGG - Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052370865 9:27663173-27663195 AAGGGAAAGGAGGATGGGGGAGG - Intergenic
1052923496 9:33992587-33992609 GAGGGGCAGTAGGATGGGGAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054743045 9:68827831-68827853 AAAAGGAAGCAGGAGGCGCAGGG + Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1057081986 9:92180085-92180107 AAGGGAAGGCAGGAGGCAGAAGG + Intergenic
1057757345 9:97848742-97848764 AAGGGGAAGTCGGCTCCGGACGG - Intergenic
1057972053 9:99567836-99567858 AAGGGGAAGAAGGCTGGGCACGG + Intergenic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058228642 9:102398064-102398086 AAGGGGGAGGACGATGTGGAAGG + Intergenic
1060052989 9:120390331-120390353 AAGGAGAAGCAGCATGCCCACGG - Intronic
1060654410 9:125359203-125359225 AAGGGGATGCAGGGAGGGGAGGG - Intronic
1060719398 9:125965205-125965227 AAGGGCCAGCAGCATGTGGAAGG + Intronic
1061374481 9:130215904-130215926 AAGAGGGAGCAGGATGTGGGAGG - Intronic
1061498256 9:130987931-130987953 GAGCGGAGGCAGGAAGCGGAGGG + Intergenic
1061972291 9:134051265-134051287 AAGGGGGAGCAGGATTTGGGAGG + Intronic
1062022004 9:134324183-134324205 AAGGAGCAGCAGGCCGCGGACGG - Intronic
1062026578 9:134343414-134343436 CAGGGGCTGCAGGATGCTGACGG - Intronic
1062352875 9:136147826-136147848 AGGGGGAAGCAGGATCCTCAGGG + Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186046631 X:5543917-5543939 AAGGGGAAGAAGCAGGCAGAAGG - Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1188353982 X:29167281-29167303 AAGGGGAAGCGGAATGGGAAGGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190720006 X:53139862-53139884 AAGGGGGAGGAGGAAGGGGAAGG + Intergenic
1190971492 X:55353335-55353357 AAGGGGAAGAAGAATGCCTATGG + Intergenic
1191850429 X:65582040-65582062 AAGGCAAAGCAGGATGTGGTTGG + Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1192214175 X:69146703-69146725 CAAGGGAAGCAGGAAGCGGGAGG + Intergenic
1192418357 X:71005082-71005104 AAGAGGAAGAGGGATGGGGATGG - Intergenic
1192433660 X:71129153-71129175 AAGGTGAAGGAGGATGCGGCAGG - Exonic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192566176 X:72165376-72165398 AAGGGGCAGCCAGAGGCGGACGG + Intergenic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1194158072 X:90417934-90417956 AAAGGGAAGCAGGATGGGCGTGG + Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1195294851 X:103465994-103466016 AAGGGGCAGAAGGAAGCAGAGGG - Intergenic
1195676892 X:107513421-107513443 AAGGGGCAGGAGGATGGGCAGGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197097498 X:122613037-122613059 TTGGGGAAGAAGTATGCGGATGG + Intergenic
1197412708 X:126138858-126138880 ATGGGCAACCAGGATGCGGGGGG + Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199851135 X:151725537-151725559 ATGGTGAAGCAGGATGCTGTGGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic