ID: 1027111553

View in Genome Browser
Species Human (GRCh38)
Location 7:75443688-75443710
Sequence CGCCTCCGCCTTCGAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2390
Summary {0: 2, 1: 1, 2: 21, 3: 484, 4: 1882}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027111553_1027111558 -2 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111558 7:75443709-75443731 CGGGCGGATCACCTGAGGTCAGG 0: 5169
1: 39885
2: 101917
3: 112252
4: 95582
1027111553_1027111561 25 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111561 7:75443736-75443758 CAAGACCGGCCTGACCAATATGG 0: 17
1: 1367
2: 18250
3: 84085
4: 142632
1027111553_1027111557 -7 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111557 7:75443704-75443726 GGAGGCGGGCGGATCACCTGAGG 0: 86
1: 4985
2: 33721
3: 87905
4: 112318
1027111553_1027111560 11 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111560 7:75443722-75443744 TGAGGTCAGGAGTTCAAGACCGG 0: 528
1: 1445
2: 2356
3: 2430
4: 2222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027111553 Original CRISPR CGCCTCCGCCTTCGAAGTGC TGG (reversed) Intronic
Too many off-targets to display for this crispr