ID: 1027111558

View in Genome Browser
Species Human (GRCh38)
Location 7:75443709-75443731
Sequence CGGGCGGATCACCTGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354805
Summary {0: 5169, 1: 39885, 2: 101917, 3: 112252, 4: 95582}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027111552_1027111558 -1 Left 1027111552 7:75443687-75443709 CCCAGCACTTCGAAGGCGGAGGC 0: 2
1: 1
2: 67
3: 1131
4: 3206
Right 1027111558 7:75443709-75443731 CGGGCGGATCACCTGAGGTCAGG 0: 5169
1: 39885
2: 101917
3: 112252
4: 95582
1027111548_1027111558 7 Left 1027111548 7:75443679-75443701 CCTGTATTCCCAGCACTTCGAAG 0: 2
1: 1
2: 176
3: 4436
4: 38511
Right 1027111558 7:75443709-75443731 CGGGCGGATCACCTGAGGTCAGG 0: 5169
1: 39885
2: 101917
3: 112252
4: 95582
1027111553_1027111558 -2 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111558 7:75443709-75443731 CGGGCGGATCACCTGAGGTCAGG 0: 5169
1: 39885
2: 101917
3: 112252
4: 95582
1027111547_1027111558 26 Left 1027111547 7:75443660-75443682 CCAGACGCAGTGGCTCATGCCTG 0: 281
1: 7518
2: 42720
3: 106921
4: 144572
Right 1027111558 7:75443709-75443731 CGGGCGGATCACCTGAGGTCAGG 0: 5169
1: 39885
2: 101917
3: 112252
4: 95582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027111558 Original CRISPR CGGGCGGATCACCTGAGGTC AGG Intronic
Too many off-targets to display for this crispr