ID: 1027111560

View in Genome Browser
Species Human (GRCh38)
Location 7:75443722-75443744
Sequence TGAGGTCAGGAGTTCAAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8981
Summary {0: 528, 1: 1445, 2: 2356, 3: 2430, 4: 2222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027111553_1027111560 11 Left 1027111553 7:75443688-75443710 CCAGCACTTCGAAGGCGGAGGCG 0: 2
1: 1
2: 21
3: 484
4: 1882
Right 1027111560 7:75443722-75443744 TGAGGTCAGGAGTTCAAGACCGG 0: 528
1: 1445
2: 2356
3: 2430
4: 2222
1027111548_1027111560 20 Left 1027111548 7:75443679-75443701 CCTGTATTCCCAGCACTTCGAAG 0: 2
1: 1
2: 176
3: 4436
4: 38511
Right 1027111560 7:75443722-75443744 TGAGGTCAGGAGTTCAAGACCGG 0: 528
1: 1445
2: 2356
3: 2430
4: 2222
1027111552_1027111560 12 Left 1027111552 7:75443687-75443709 CCCAGCACTTCGAAGGCGGAGGC 0: 2
1: 1
2: 67
3: 1131
4: 3206
Right 1027111560 7:75443722-75443744 TGAGGTCAGGAGTTCAAGACCGG 0: 528
1: 1445
2: 2356
3: 2430
4: 2222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027111560 Original CRISPR TGAGGTCAGGAGTTCAAGAC CGG Intronic
Too many off-targets to display for this crispr