ID: 1027116544

View in Genome Browser
Species Human (GRCh38)
Location 7:75486018-75486040
Sequence ATCCAGGCGGGTGTCCTTCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 3, 1: 3, 2: 5, 3: 76, 4: 360}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027116538_1027116544 -1 Left 1027116538 7:75485996-75486018 CCGGGCCGGGCCTACGGGGCAAA 0: 5
1: 3
2: 0
3: 4
4: 92
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116537_1027116544 0 Left 1027116537 7:75485995-75486017 CCCGGGCCGGGCCTACGGGGCAA 0: 5
1: 3
2: 1
3: 5
4: 98
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116523_1027116544 30 Left 1027116523 7:75485965-75485987 CCTCACCAAGGCTGTTCTGCTCC 0: 5
1: 2
2: 4
3: 20
4: 217
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116533_1027116544 8 Left 1027116533 7:75485987-75486009 CCGAGGGGCCCGGGCCGGGCCTA 0: 6
1: 0
2: 1
3: 24
4: 208
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116539_1027116544 -6 Left 1027116539 7:75486001-75486023 CCGGGCCTACGGGGCAAATCCAG 0: 5
1: 3
2: 0
3: 9
4: 152
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116524_1027116544 25 Left 1027116524 7:75485970-75485992 CCAAGGCTGTTCTGCTCCCGAGG 0: 4
1: 2
2: 3
3: 15
4: 174
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360
1027116532_1027116544 9 Left 1027116532 7:75485986-75486008 CCCGAGGGGCCCGGGCCGGGCCT 0: 8
1: 0
2: 3
3: 46
4: 434
Right 1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG 0: 3
1: 3
2: 5
3: 76
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027116544 Original CRISPR ATCCAGGCGGGTGTCCTTCT CGG Exonic
900895738 1:5481714-5481736 CTCCATGTGGCTGTCCTTCTGGG - Intergenic
902965316 1:19996669-19996691 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
903529706 1:24020870-24020892 ACCCAGGCTGGAGTCCATCTTGG + Intergenic
904560588 1:31394754-31394776 ATTCCTGCGGGTGTTCTTCTCGG + Intergenic
905355408 1:37380441-37380463 ATACAGGCAGGTGCCCCTCTAGG - Intergenic
905897014 1:41554871-41554893 ATACAGGCGGGTGTCCCTCTGGG - Intronic
906570081 1:46830550-46830572 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
909457038 1:75861645-75861667 ATACAGGCGGTTGCCCCTCTGGG - Intronic
909557497 1:76969793-76969815 ATACAGGCAGGTGCCCCTCTGGG + Intronic
910318898 1:85921433-85921455 ATACAGGCAGGTGCCCCTCTGGG + Intronic
910829188 1:91442557-91442579 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
910915171 1:92280228-92280250 AAACAGGCGGGTGCCCCTCTGGG + Intronic
910956929 1:92716228-92716250 ATACAGGCAGGTGCCCCTCTGGG + Intronic
911128934 1:94369670-94369692 ATACAGGTGGGTGCCCTTCTGGG - Intergenic
911342143 1:96651997-96652019 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
911596058 1:99800267-99800289 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
911700721 1:100949389-100949411 ACACAGGCGGGTGCCCCTCTGGG - Intronic
912463291 1:109851803-109851825 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
912646227 1:111394500-111394522 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
913081171 1:115388700-115388722 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
913102717 1:115584215-115584237 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
914208966 1:145561217-145561239 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
914369208 1:147007276-147007298 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
915976069 1:160390276-160390298 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
916469445 1:165108927-165108949 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
916534551 1:165691131-165691153 ATACAGGTGGGTGCCCTTCTGGG + Intronic
916645839 1:166784515-166784537 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
917181496 1:172302637-172302659 ATACAGGCAGGTGCCCCTCTGGG + Intronic
917308733 1:173655493-173655515 ATACAGGTGGGTGCCCCTCTGGG - Intronic
917579128 1:176356603-176356625 ATACAGGCAGGTGTCCCTCTGGG + Intergenic
917743738 1:177986772-177986794 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
918159359 1:181882962-181882984 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
918537234 1:185587139-185587161 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
918616522 1:186550687-186550709 ATACAGGCAGGTGTCCCCCTGGG - Intergenic
918890282 1:190257860-190257882 ATACAGGTGGGTGCCCCTCTGGG - Intronic
918968166 1:191378185-191378207 ATACAGGCAGGTGACCCTCTGGG - Intergenic
919730201 1:200908868-200908890 GTCCAGGCTGGTTTCCTTCCAGG - Exonic
920064480 1:203257224-203257246 ATACAGGAGGGTGTCCCTCTGGG + Intronic
920993093 1:210959295-210959317 ATATAGGCGGGTGCCCCTCTGGG - Intronic
921219327 1:212962028-212962050 ACCCAGGCTGGTGACCTGCTTGG + Intronic
923032019 1:230256691-230256713 ATCAAGCCAAGTGTCCTTCTAGG + Intronic
923067936 1:230537564-230537586 ACCCAGGCAGGTTTCCTGCTGGG - Intergenic
1064981850 10:21173768-21173790 ATCCAGGCAGTTGACTTTCTCGG + Intronic
1065076980 10:22090016-22090038 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1065230986 10:23598487-23598509 ATAAAGGCGGGTGCCCCTCTGGG - Intergenic
1066297612 10:34068240-34068262 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1067231058 10:44411077-44411099 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
1068169131 10:53370847-53370869 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1068609471 10:59043236-59043258 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1068789098 10:61008259-61008281 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1069370054 10:67738190-67738212 ATACAGGCGGGTGTCCCTCTGGG + Intergenic
1070064753 10:73022257-73022279 ATACAGGCGGGTGCCCCTCTGGG + Intronic
1070980405 10:80641172-80641194 ATACAGGCAGGTGGCCCTCTGGG - Intronic
1072245050 10:93535737-93535759 ATGCAGGTGGGTGCCCCTCTGGG + Intergenic
1072374435 10:94800401-94800423 ATACACGTGGGTGTCCCTCTGGG - Intronic
1073745942 10:106467993-106468015 ATACAGGCAGGTGTCCCTCTGGG + Intergenic
1076238256 10:128882732-128882754 GTCCATCCGGGGGTCCTTCTTGG - Intergenic
1077655613 11:4016427-4016449 ATACAGGCGGGTGACCCTCTGGG - Intronic
1078321677 11:10340352-10340374 ATACAGGTGGGTGCCCTTCTGGG + Intronic
1078482689 11:11692282-11692304 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
1078560475 11:12366711-12366733 AATCAGGCGGGTGCCCCTCTGGG + Intergenic
1078690062 11:13570584-13570606 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1078994105 11:16679226-16679248 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1079653935 11:22965287-22965309 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1081143763 11:39536181-39536203 ATACAGGCGAGTGCCCTTCTGGG - Intergenic
1081368451 11:42266539-42266561 ATCCAGGCAGCTATCCTTTTGGG + Intergenic
1081682346 11:45017187-45017209 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1083531639 11:63428547-63428569 ATACAGGCAGGTGTCCCTCTGGG + Intergenic
1086456804 11:86967450-86967472 GTACAGGCGGGTGCCCCTCTGGG - Intergenic
1086645052 11:89209725-89209747 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1086811976 11:91321674-91321696 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1087003391 11:93444428-93444450 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1087332020 11:96792905-96792927 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1087364141 11:97198083-97198105 AAACAGGCGGGTGTCCCTCTGGG - Intergenic
1087898339 11:103612078-103612100 ATACAGTCGGGTGCCCCTCTGGG + Intergenic
1093085874 12:14866733-14866755 ATACAGGCAGGTGCCCCTCTGGG - Intronic
1093998234 12:25665809-25665831 ATGCAGGCGGGTGCCCCTCTGGG - Intergenic
1094311885 12:29093115-29093137 ATACAGGCAGGTGCCCTTCAGGG + Intergenic
1094430693 12:30366731-30366753 ATACAGGAGGGTGCCCCTCTGGG - Intergenic
1095442713 12:42254262-42254284 ATACAGGTGGGTGCCCCTCTGGG - Intronic
1096950163 12:55460052-55460074 ATACAGGTGGGTGTCCCTCTGGG + Intergenic
1097148587 12:56958985-56959007 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1099216710 12:79862079-79862101 ATACAGGGGGGTGCCCTTCTAGG + Intronic
1101301652 12:103489329-103489351 ATACAGGTGGGTGCCCCTCTGGG - Intronic
1101361880 12:104034908-104034930 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1101628554 12:106470837-106470859 ATACAGGCAGGTGCCCCTCTGGG - Intronic
1104265387 12:127227556-127227578 ATCCAGGCTGATCTCTTTCTAGG - Intergenic
1104907233 12:132219884-132219906 ACCCAGGCGGGTGTCACCCTGGG - Intronic
1104907250 12:132219925-132219947 ACCCAGGCGGGTGTCACCCTGGG - Intronic
1106094965 13:26635888-26635910 ATACAGGCGGATGCCCCTCTGGG - Intronic
1106753359 13:32797079-32797101 GTCCAAGAGGGTGGCCTTCTAGG + Intergenic
1106816939 13:33418706-33418728 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1110305612 13:73983913-73983935 ATCCAGGCAGGTGGTATTCTAGG + Intronic
1111233183 13:85372082-85372104 ATCCAGATAGGTGTCCTACTTGG - Intergenic
1111593696 13:90383845-90383867 ATCCAGGCAGCAGTCTTTCTAGG + Intergenic
1113348726 13:109507682-109507704 ATACAGGCGGGTGCCCCTCCGGG - Intergenic
1113795241 13:113053440-113053462 ATCCTGGTGGGTGAGCTTCTGGG + Intronic
1114964423 14:27939693-27939715 ATACAGGTAGGTGCCCTTCTGGG + Intergenic
1115743264 14:36410131-36410153 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1115818508 14:37188522-37188544 ATACAGACGGGTGCCCCTCTGGG + Intergenic
1116482838 14:45412148-45412170 ATATAGGCAGGTGACCTTCTGGG + Intergenic
1117005620 14:51418554-51418576 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1117056028 14:51912678-51912700 ATCCAGGCTGGTAACCTTGTAGG - Intronic
1117081737 14:52158511-52158533 ATACAGGCGGATGCCCCTCTGGG + Intergenic
1117123621 14:52596200-52596222 ATACAGGCGGGTGCCCCTCTGGG - Intronic
1117172848 14:53117921-53117943 AAACAGGCGGGTGCCCCTCTGGG + Intronic
1117257153 14:53989813-53989835 ATCCAGGAGGGTGTCATAGTTGG - Intergenic
1117288583 14:54310651-54310673 ATGCATGCGGGTGTCCTCCCTGG - Intergenic
1118559826 14:67067330-67067352 ATACAGGCAGGTGTCCCTCTGGG - Intronic
1120616450 14:86711250-86711272 ATCCAGGTGAGTTTCCTTCTAGG + Intergenic
1120619845 14:86750373-86750395 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
1121139474 14:91528562-91528584 AACCAGACGAGTGTCTTTCTGGG - Intergenic
1121393374 14:93595573-93595595 ATCCACGCGGGGGCCATTCTGGG + Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124918107 15:33996447-33996469 ATACAGGCGGGTGCCCCTCTGGG + Intronic
1125324630 15:38524452-38524474 AGCCAGGAGGGTGTCGTTCCGGG + Intronic
1126086989 15:45020476-45020498 ATACAGGCGGGTGCCCCTGTGGG - Intergenic
1126476390 15:49069307-49069329 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1126742149 15:51787618-51787640 ATACAGGTGGGTGTCCCTCTGGG + Intronic
1127138063 15:55944753-55944775 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1127253801 15:57270945-57270967 ATACAGGTGGGTGCCCCTCTGGG - Intronic
1128782272 15:70368455-70368477 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1129578553 15:76780644-76780666 ATGCAGGTGAGTGCCCTTCTGGG + Intronic
1132001797 15:98188001-98188023 ATCCAGCAGGGTGTCCCTTTGGG - Intergenic
1132287881 15:100678963-100678985 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1132950304 16:2558048-2558070 AGCAAGGCTGGTGTCCTTCCAGG + Intronic
1132964044 16:2642122-2642144 AGCAAGGCTGGTGTCCTTCCAGG - Intergenic
1133306774 16:4814613-4814635 ATCCAGGAGGGGGCCCGTCTGGG - Exonic
1134793164 16:17009615-17009637 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1135512130 16:23094614-23094636 ATACAGGCGGGTGCCTGTCTGGG + Intronic
1135865082 16:26093355-26093377 ATACAGGCGGGTGCTCCTCTGGG + Intronic
1136779939 16:32891597-32891619 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1136890674 16:33969923-33969945 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1137461452 16:48668015-48668037 ACACAGGTGGGTGCCCTTCTAGG - Intergenic
1139298929 16:65927432-65927454 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1139374758 16:66490009-66490031 ACCCAGGTGGCTGTCCTTCCTGG + Intronic
1140326983 16:74013905-74013927 GTCCAGGCTGGTCTCATTCTGGG + Intergenic
1140383623 16:74513405-74513427 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1142220501 16:88852125-88852147 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1203082358 16_KI270728v1_random:1153685-1153707 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1143319446 17:6058612-6058634 ATCCAGGCTGGAGTGCATCTCGG - Intronic
1144724566 17:17495416-17495438 GTCCAGGCTGCTGTTCTTCTTGG + Exonic
1145861279 17:28212321-28212343 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1146145439 17:30412255-30412277 ATACAGGCAGGTGCCCCTCTGGG - Intronic
1146280870 17:31543466-31543488 AACCAGGCTGGATTCCTTCTGGG - Intergenic
1147191717 17:38741839-38741861 ATGCAGGCGGCTGTCCATCAGGG - Intronic
1148950384 17:51305686-51305708 ATACAGGCGGGTGCTCCTCTGGG + Intergenic
1148952633 17:51327161-51327183 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1149240197 17:54639935-54639957 ATACAGGCGAGTGCCCCTCTGGG + Intergenic
1149556112 17:57574566-57574588 ATCCAGGCTGGAAACCTTCTAGG - Intronic
1149696612 17:58621321-58621343 AGCCAGCCAGGTGTCCTGCTGGG + Intronic
1150094169 17:62357688-62357710 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
1154288514 18:13083999-13084021 ATACAGGCTGGTGCCCCTCTGGG - Intronic
1155225811 18:23728251-23728273 ACCCAGGCTGGTGACCTTCCTGG + Intronic
1156421683 18:36960573-36960595 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1157336520 18:46742829-46742851 ATACAGGCGGATGCCCCTCTGGG + Intronic
1158703763 18:59772091-59772113 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1160013868 18:75126085-75126107 ACCCAGGCCGGCGTCCTTCCTGG - Intergenic
1160346113 18:78134296-78134318 ATCCAGGTGTGTGTCCTTCCCGG + Intergenic
1160346140 18:78134409-78134431 ATCGAGGTGCGTGTCCTTCCTGG + Intergenic
1160346156 18:78134485-78134507 ATCGAGGTGTGTGTCCTTCCTGG + Intergenic
1160346164 18:78134523-78134545 ATCGAGGTGTGTGTCCTTCCTGG + Intergenic
1160346197 18:78134675-78134697 ATCGAGGTGTGTGTCCTTCCTGG + Intergenic
1160346279 18:78135057-78135079 ATCGAGGTGTGTGTCCTTCCTGG + Intergenic
1164110171 19:22149110-22149132 ATATAGGTGGGTGCCCTTCTGGG + Intergenic
1164875064 19:31678916-31678938 ATCCAGGGAGGTGTGCTTATTGG + Intergenic
1165003691 19:32787299-32787321 ATACAGGTGGGTGTCCCTCTGGG - Intronic
925440934 2:3884557-3884579 ATAGAGGAGGGTGGCCTTCTGGG + Intergenic
926269805 2:11356711-11356733 ATCCAGCCAGATGTCCTTCATGG - Intergenic
927028000 2:19090003-19090025 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
927221278 2:20712145-20712167 ATACAGGTGGGTGCCCCTCTGGG + Intronic
928900718 2:36315242-36315264 ATACAGGTGGGTGTCCCTCTGGG - Intergenic
929025683 2:37599567-37599589 ATATAGGCGGGTGCCCCTCTGGG - Intergenic
929944605 2:46361009-46361031 ATCCAGGGGGATGTCCATGTGGG - Exonic
930143215 2:47974263-47974285 ATACAGGTGGATGTCCGTCTGGG + Intergenic
930908854 2:56606197-56606219 AAACAGGCGGGTGCCCCTCTGGG - Intergenic
931305232 2:61021786-61021808 AAACAGGCAGGTGTCCCTCTGGG + Intronic
931306610 2:61035083-61035105 CAACAGGCGGGTGCCCTTCTGGG + Intronic
931986123 2:67744341-67744363 ATATAGGCGGGTGCCCCTCTGGG - Intergenic
932377492 2:71250790-71250812 AAACAGGCGGGTGCCCCTCTGGG - Intergenic
932868648 2:75374268-75374290 AAACAGGCGGGTGCCCCTCTGGG - Intergenic
934553786 2:95277093-95277115 AGCCCAGCGGGTGTCCTCCTGGG + Intronic
936775280 2:115965396-115965418 CTACAGGTGGGTGCCCTTCTGGG - Intergenic
937346422 2:121128816-121128838 ATCCAGGCAGGGGTCAGTCTAGG + Intergenic
937674513 2:124575186-124575208 ATTCAGGCTTGTGTCCTGCTGGG - Intronic
938343367 2:130549668-130549690 CTCCTGGCGGGTGTCCTCATCGG + Intronic
938346466 2:130571054-130571076 CTCCTGGCGGGTGTCCTCATCGG - Intronic
938975122 2:136469437-136469459 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
940720695 2:157279201-157279223 ATATAGGCGGGTGCCCCTCTGGG - Intronic
941041392 2:160627940-160627962 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
941523849 2:166581964-166581986 ATACAGGCGAGTGCCCCTCTGGG + Intergenic
942419563 2:175794223-175794245 ATCAAGGCTGCTGTCCTTCCTGG - Intergenic
942434700 2:175958328-175958350 ATACAGCCGGGTGCCCCTCTGGG + Intronic
943038401 2:182774226-182774248 ATATAGGCGGCTGCCCTTCTGGG - Intronic
943583583 2:189712363-189712385 ATACAGGCGGGTGCCCCTCTGGG + Intronic
943710857 2:191093313-191093335 ATACAGGTGGGTGCCCCTCTGGG + Intronic
945597410 2:211812418-211812440 ATACAGGCAGGTGCCCCTCTGGG - Intronic
945776631 2:214114206-214114228 ATACAGGCGGGTGCCCCTCTAGG - Intronic
946697355 2:222372810-222372832 AGCCAGGCTTGTGTCCTTCAGGG - Intergenic
946794126 2:223331251-223331273 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
947494059 2:230620010-230620032 AAACAGGCGGGTGCCCCTCTGGG + Intergenic
1171247123 20:23620709-23620731 ATACAGGTAGGTGCCCTTCTGGG - Intergenic
1171443466 20:25186227-25186249 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1171514705 20:25720105-25720127 ATACAGGAGGGTGCCCCTCTGGG - Intergenic
1172303010 20:33863046-33863068 ATCCATGGGGGTGTCCCTGTGGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174224012 20:48982381-48982403 ATACAGGCGGGTGCCCCTCTGGG - Intronic
1174605232 20:51756613-51756635 ATCCAGCCCGGTGACCTTATAGG - Intronic
1176128235 20:63485434-63485456 CTCCAGGTGGGTGTGTTTCTGGG - Intergenic
1180640934 22:17299009-17299031 ATACAGCCGGGTGCCCCTCTGGG - Intergenic
1180746854 22:18095290-18095312 AGCCTGGCGGGTGTCCTCCTGGG + Exonic
1185149097 22:49154126-49154148 AGCCTTGCGGGGGTCCTTCTTGG + Intergenic
949579897 3:5377283-5377305 ATACAGGGAGGTGCCCTTCTGGG + Intergenic
950641870 3:14353667-14353689 ACCCAGGCGGGGGCCCTGCTGGG - Intergenic
951006161 3:17618278-17618300 ATACAGGCGGGTGCCCCTCTGGG - Intronic
951471587 3:23062409-23062431 ATACAAGCGGGTGGCCCTCTAGG - Intergenic
952864073 3:37839571-37839593 ATACAGGCGGGTGCTCCTCTGGG + Intergenic
953218994 3:40950643-40950665 ATACAGGTGGGTGACCCTCTAGG - Intergenic
953521873 3:43650427-43650449 ATCAAGTCTGGTGTCCTTTTTGG + Intronic
953653052 3:44823389-44823411 ATACAGGTGGGTGCCCCTCTGGG - Intronic
955895440 3:63694668-63694690 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
956396555 3:68832563-68832585 ATACAGGTGGGTGCCCCTCTGGG - Intronic
956477341 3:69636722-69636744 ATACAGGTGGGTGTCCCTCTTGG - Intergenic
957917790 3:86708741-86708763 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
958011296 3:87883063-87883085 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
958413904 3:93852160-93852182 ATACAGGTGGGTGCCCTTCTGGG - Intergenic
959097348 3:101970784-101970806 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
959290642 3:104469199-104469221 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
959940091 3:112072346-112072368 ATATAGGCGGGTGCCCCTCTGGG - Intronic
960065453 3:113367324-113367346 ATACAGGCGGGTGCCCTTCTGGG + Intronic
960276734 3:115737869-115737891 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
960478867 3:118163372-118163394 ATACAGGCGGGTGCCCCTTTGGG + Intergenic
960565863 3:119130798-119130820 ATACAGGCAGGTGCCCCTCTGGG + Intronic
960656000 3:120004533-120004555 ATACAGGTGGGTGCCCCTCTGGG + Intronic
960835994 3:121907752-121907774 TTACAGGCGGGTGTCCCTCTGGG - Intronic
960890716 3:122444646-122444668 ATACAGGCGGGTGCCCCTCTGGG + Intronic
962137068 3:132746550-132746572 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
962291512 3:134140628-134140650 ATACAGGTGGGTGCCCCTCTGGG + Intronic
962341408 3:134587576-134587598 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
962675238 3:137751438-137751460 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
963531579 3:146477850-146477872 ATACAGGCAGGTGCCCCTCTGGG + Intronic
964270088 3:154945906-154945928 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
964995066 3:162868541-162868563 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
965200861 3:165655890-165655912 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
966455242 3:180107650-180107672 ATCCAGGTTGGGGTCCTTCCAGG - Intergenic
966477636 3:180368095-180368117 ATACAGGCGGGTGCTCCTCTGGG + Intergenic
968156026 3:196381246-196381268 ATACAGGCGGCTGCCCCTCTGGG + Intronic
968408556 4:364708-364730 ATACAGGCAGGTGACCCTCTGGG - Intronic
970182894 4:13417507-13417529 GTACAGGCAGGTGCCCTTCTGGG + Intronic
970917530 4:21352889-21352911 ATACAGGTGGGTGCCCCTCTGGG + Intronic
970975675 4:22040564-22040586 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
971820375 4:31545764-31545786 AGCCAAGAGGGTATCCTTCTTGG + Intergenic
973237583 4:47922413-47922435 ATTCAGGCAGGTGCCCCTCTGGG - Intronic
973313009 4:48729503-48729525 ATACAGGCGGGTGCCTCTCTGGG + Intronic
973835821 4:54807815-54807837 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
973883604 4:55297893-55297915 AAACAGGCGGGTGCCCCTCTGGG + Intergenic
974307346 4:60158031-60158053 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
974654389 4:64800235-64800257 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
974871812 4:67653293-67653315 ATACAGGTGGGTGCCCCTCTGGG + Intronic
975094045 4:70437079-70437101 ATACAGGTGGGTACCCTTCTGGG - Intronic
975219393 4:71797065-71797087 ATACAGGCAGGTGCCCCTCTGGG - Intronic
975364909 4:73518212-73518234 ATACAGGCAGGTGCCCCTCTAGG - Intergenic
975449358 4:74506075-74506097 AAACAGGCAGGTGTCCCTCTGGG + Intergenic
975520931 4:75300360-75300382 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
976552517 4:86413285-86413307 ATACAGGTGGGTGCCCCTCTGGG - Intronic
976585441 4:86791618-86791640 AAACAGGCGGGTGCCCCTCTGGG + Intronic
976760138 4:88539679-88539701 ATACAGGCAGGTGACCCTCTGGG + Intronic
977194786 4:94045216-94045238 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
977203793 4:94147901-94147923 ATATAGGCGGGTGCCCCTCTGGG - Intergenic
977511273 4:97965608-97965630 ATACAGGCTGGTGCCCCTCTGGG + Intronic
978148792 4:105409657-105409679 ATACAGGTGGGTGCCCCTCTGGG + Intronic
978269812 4:106875476-106875498 AAACAGGCGGGTGGCCCTCTAGG - Intergenic
978464599 4:108994729-108994751 ATACAGGCGGGTGCCCCTCTGGG + Intronic
979315315 4:119255104-119255126 ATACAGGCGGGTGCCCCTCTGGG - Intronic
979510633 4:121550059-121550081 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
979730093 4:124013782-124013804 ATATAGGCGGGTGCCCCTCTGGG - Intergenic
980037757 4:127904874-127904896 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
980558667 4:134442524-134442546 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
981479958 4:145228474-145228496 ATACAGACAGGTGACCTTCTGGG - Intergenic
981655988 4:147112690-147112712 ATATAGGCGGGTGACCCTCTGGG + Intergenic
984224491 4:177017953-177017975 ATACAGGAGGGTGCCCCTCTGGG + Intergenic
986127033 5:4892950-4892972 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
986149545 5:5115045-5115067 ATACAGGTGGGTGCCCTTCTGGG - Intergenic
986877237 5:12126395-12126417 ATACAGGCAGGTGTCCCTCTGGG + Intergenic
987179959 5:15356834-15356856 ATACAGGCGGGTGCCCCTCTTGG + Intergenic
987445052 5:18006774-18006796 ATACAGGCAGGTGCCCTCCTGGG + Intergenic
988309673 5:29541553-29541575 ATACAGGTGGGTGACCCTCTGGG - Intergenic
988478795 5:31612020-31612042 ATCCAGGCTGGTGCTCCTCTTGG - Intergenic
989334706 5:40302124-40302146 AAACAGGCGGGTGCCCTTCTGGG - Intergenic
989337591 5:40336652-40336674 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
989516865 5:42353925-42353947 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
989522405 5:42417798-42417820 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
991199944 5:63980285-63980307 ATAAAGGCGGGTGCCCCTCTGGG - Intergenic
991280716 5:64910327-64910349 ATACAGGCAGGTGCCCCTCTGGG - Intronic
992756542 5:79911754-79911776 ATGCAGGTGGGTGCCCCTCTGGG + Intergenic
992854445 5:80846282-80846304 AAACAGGCGGGTGCCCCTCTGGG - Intronic
993470926 5:88306478-88306500 ATATAGGCGGCTGCCCTTCTGGG + Intergenic
993497366 5:88622846-88622868 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
993656268 5:90581622-90581644 ATACAGGCAGGTGCCCCTCTGGG - Intronic
993947945 5:94137824-94137846 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
994636632 5:102352056-102352078 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
995642911 5:114278226-114278248 ATACAGGCAGGTGTCCCTCTGGG - Intergenic
996147232 5:119991514-119991536 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
996859150 5:128044672-128044694 AAACAGGCGGGTGCCCCTCTGGG + Intergenic
997094348 5:130893989-130894011 ATGCAGGCGGGTGCCCCTCTGGG + Intergenic
997245911 5:132349150-132349172 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
997496967 5:134336706-134336728 ATACAGGCAGGTGCCCCTCTGGG - Intronic
998872426 5:146565967-146565989 AGCCAGGGGTGTGTCCTTGTTGG + Intergenic
999045837 5:148468494-148468516 ATCCATAGGGGTGTCTTTCTAGG + Intronic
999698074 5:154203730-154203752 ATCCAAGGGAGTGTCCTGCTAGG - Intronic
999944553 5:156581297-156581319 ATACAGGCAGGTGCCCCTCTGGG - Intronic
999963565 5:156783573-156783595 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1000069035 5:157721684-157721706 ATACAGGTGGGTGACCCTCTGGG + Intergenic
1002437493 5:179240606-179240628 ATCCAGTGGGGAGTCCTTTTTGG + Intronic
1003434341 6:6072099-6072121 ATACAGGCTGGTGCCCCTCTGGG - Intergenic
1003763925 6:9214222-9214244 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
1004056118 6:12140104-12140126 ATACAGGCGGGTACCCCTCTGGG + Intronic
1006616671 6:35332703-35332725 ATACAGGCGGGTGCTCCTCTGGG + Intergenic
1009655677 6:66541666-66541688 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1009998093 6:70919776-70919798 ATACAGGCGGGTGCCCCTCTAGG - Intronic
1010003936 6:70974891-70974913 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1010297966 6:74222679-74222701 AAACAGGCAGGTGTCCCTCTGGG - Intergenic
1010667114 6:78643844-78643866 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1010755616 6:79663544-79663566 ATACAGGCGGGTGCCCCTCTGGG - Intronic
1010837962 6:80612867-80612889 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1011062928 6:83292500-83292522 ATACAGGCGGGTGCCTCTCTGGG - Intronic
1011234669 6:85202752-85202774 ATACAGGTGGGTGCCCTTCTGGG + Intergenic
1011245109 6:85314366-85314388 ATACAGGGGGGTGCCCCTCTGGG - Intergenic
1011288670 6:85752397-85752419 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1011298212 6:85846812-85846834 ATACAGGTGGGTGCCCCTCTAGG - Intergenic
1011884687 6:92079029-92079051 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1012598050 6:101062754-101062776 ATACAGGCGGGTGTCCCTCTGGG + Intergenic
1012725798 6:102808814-102808836 ATACAAGTGGGTGCCCTTCTGGG - Intergenic
1012878493 6:104757304-104757326 ATACAGGCGGGTGCCCCTCTGGG + Intronic
1012881885 6:104800480-104800502 ATATAGGCGGGTGCCCCTCTGGG + Intronic
1013578251 6:111507101-111507123 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1014013358 6:116501632-116501654 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1014184726 6:118421788-118421810 ATAGAGGTGGGTGCCCTTCTGGG + Intergenic
1014461685 6:121703676-121703698 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1014907176 6:127043989-127044011 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1015046221 6:128779621-128779643 ATACAGGCAGGTGACCCTCTGGG - Intergenic
1015054103 6:128878463-128878485 ATCCAGGCAATTGTGCTTCTGGG + Intergenic
1015080177 6:129214590-129214612 ATTCATGCGGGTGTATTTCTGGG + Intronic
1016102124 6:140115465-140115487 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1016584982 6:145674055-145674077 ATACAGGCGGGTGCCCCTCTGGG + Intronic
1016655584 6:146515059-146515081 ATACAGGTGGGTGTCCCTCTGGG - Intergenic
1017356944 6:153520869-153520891 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1018075973 6:160214122-160214144 ATATAGGCGGGTGCCCCTCTGGG - Intronic
1020046762 7:5046221-5046243 ATCCAGGCGGGTGTCCTTCCCGG - Exonic
1020292137 7:6730148-6730170 ATCCAGGAGGGTGTCCTTCCCGG - Intergenic
1020443150 7:8240159-8240181 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1020659442 7:10965447-10965469 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1020774081 7:12431727-12431749 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1020810048 7:12840270-12840292 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1021238678 7:18174833-18174855 ATACAGGCAGGTGCCCATCTGGG - Intronic
1021870500 7:25001648-25001670 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1022135963 7:27448923-27448945 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1022745313 7:33166235-33166257 ATACAGGAGGGTGCCCTTCTGGG - Intronic
1022848376 7:34234917-34234939 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1022867055 7:34432069-34432091 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1022941760 7:35248807-35248829 AACCATCCGGGTGTCCTTTTCGG - Exonic
1023034769 7:36120697-36120719 ATACAGACGGGTGCCCCTCTGGG + Intergenic
1023146291 7:37153921-37153943 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1023311054 7:38886786-38886808 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1023651137 7:42370819-42370841 ATGCAGGCGGGTGCCCCTCTGGG - Intergenic
1024130013 7:46341700-46341722 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1026727312 7:72879709-72879731 ATCCAGGCGGGTGTCCTTCTCGG - Exonic
1027116544 7:75486018-75486040 ATCCAGGCGGGTGTCCTTCTCGG + Exonic
1027121838 7:75527720-75527742 ATCCAGGCGGGTGTCCTTCTGGG + Intergenic
1027275283 7:76549685-76549707 ATCCAGGTGGGTGTCCTTCTCGG - Intergenic
1027574568 7:79915814-79915836 ATACAGGCGGGTGCTCCTCTGGG + Intergenic
1027827833 7:83138608-83138630 ATCCAGGCTGGAGTGCTTCTCGG - Intronic
1028341004 7:89719464-89719486 ATACAGGCAGGTGCCCCTCTTGG + Intergenic
1028796936 7:94913176-94913198 ATACAGGCTGGTGTCCCACTTGG - Intronic
1028836199 7:95377536-95377558 ATACAGGCGGATGCCCCTCTGGG + Intronic
1029720994 7:102364235-102364257 ATCCAGGCGGGGGTCCTTCTCGG - Exonic
1029810120 7:103038579-103038601 AAACAGGCGGGTGCCCCTCTGGG + Intronic
1031157137 7:118122963-118122985 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1031591201 7:123594662-123594684 ATACAGGCAGGTGACCCTCTGGG - Intronic
1031803611 7:126279444-126279466 ATACAAGTGGGTGTCCCTCTGGG - Intergenic
1031905106 7:127451700-127451722 ATACAGGTGGCTGCCCTTCTGGG + Intergenic
1032250630 7:130254421-130254443 ATACAGGCGGGAGCCCCTCTGGG - Intergenic
1032320827 7:130885113-130885135 CTCCAAGGGGGTGTCCTTATAGG + Intergenic
1034565880 7:151915459-151915481 ATCCAGGCAGGGGCCCTTGTGGG + Intergenic
1036804431 8:11820222-11820244 ATATAGGTGGGTGTCCTTCTTGG - Intronic
1039624278 8:39032049-39032071 ACACAGGCGGGTGCCCCTCTGGG - Intronic
1041221603 8:55656890-55656912 ATATAGGCGGGTGCCCCTCTGGG + Intergenic
1042541148 8:69907997-69908019 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1042614194 8:70631265-70631287 ATATAGGCAGGTGGCCTTCTGGG - Intronic
1042833528 8:73056521-73056543 ATACAGGCGGGTGCCTCTCTGGG + Intergenic
1042853466 8:73240335-73240357 ATATAGGTGGGTGCCCTTCTGGG - Intergenic
1043129339 8:76441791-76441813 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
1043844644 8:85150447-85150469 AAACAGGTGGGTGCCCTTCTGGG + Intergenic
1044470575 8:92562220-92562242 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1044798903 8:95933290-95933312 ATACACGCGGGTGCCCCTCTAGG - Intergenic
1045123470 8:99063837-99063859 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1045157398 8:99492244-99492266 ATACAGGCGGATGCCCCTCTGGG - Intronic
1045592206 8:103610928-103610950 ATTCAGGCGTGAATCCTTCTGGG + Intronic
1046115180 8:109776337-109776359 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1046607974 8:116391470-116391492 ATGCAGGCAGGTGCCCCTCTGGG + Intergenic
1047129420 8:122001990-122002012 ATACAGGCAGCTGCCCTTCTGGG + Intergenic
1047473382 8:125201570-125201592 ATACAGGCGGGTGCCCCTCTGGG - Intronic
1047931612 8:129733429-129733451 ATACAGGCGGATGCCCCTCTGGG + Intergenic
1048149741 8:131883130-131883152 ATACAGGCAGGTGTCCCTCTGGG - Intergenic
1048521194 8:135157014-135157036 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1050855537 9:10349296-10349318 ATCCAGGCAGGTCTCATTTTAGG - Intronic
1051876960 9:21803157-21803179 CTCCAGCCGGGTGTCTTTCTTGG - Intronic
1052063831 9:23992438-23992460 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1052800096 9:32958544-32958566 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1055614313 9:78054963-78054985 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1056668136 9:88598061-88598083 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1057769024 9:97950755-97950777 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
1060133886 9:121133017-121133039 ATACAGGCGGGTGCCCCTCTGGG - Intronic
1060326209 9:122618391-122618413 ATACAGGCGGGTGCCCCTCTGGG - Intergenic
1062042400 9:134410154-134410176 CTCCTGGAGGGTGTCCTCCTTGG + Intronic
1203775519 EBV:71025-71047 ATCCAGCCATGTGTCCTTGTTGG + Intergenic
1186866504 X:13725365-13725387 ATATAGGCGGGTGCCCCTCTGGG + Intronic
1189936969 X:46079987-46080009 ATACAGGCGGGTGCCCCTCTTGG - Intergenic
1189978395 X:46485747-46485769 ATACAGGCAGGTGCCCCTCTGGG - Intronic
1191073667 X:56429455-56429477 ATACATGCGGGTGCCCCTCTGGG - Intergenic
1191084348 X:56547958-56547980 ATATAGGCAGGTGTCCCTCTGGG + Intergenic
1192077437 X:68014470-68014492 ATCCTGGGGGTGGTCCTTCTGGG + Intergenic
1192393710 X:70756381-70756403 ATACAGGTGGGTGCCCCTCTGGG + Intronic
1192406483 X:70890972-70890994 ATACAGGCGGGTGCCCCTCTGGG + Intronic
1192678904 X:73230587-73230609 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1192901453 X:75502268-75502290 ATCCAGTCTGATGTCCTTATAGG - Intronic
1193001619 X:76568793-76568815 AAACAGGCGGGTGACCCTCTTGG + Intergenic
1193281457 X:79655834-79655856 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1193477301 X:81982217-81982239 ATACAGGTGGGTGCCCCTCTGGG + Intergenic
1194341962 X:92716309-92716331 ATACAAGCCGGTGCCCTTCTGGG + Intergenic
1194677779 X:96814909-96814931 ATACAGGCGGGTGACCCTCCAGG - Intronic
1194726986 X:97410135-97410157 ATACAGGCGAGTGACCCTCTGGG + Intronic
1195622109 X:106967071-106967093 ATACAGGCAGGTGCCCCTCTGGG + Intronic
1195729189 X:107948832-107948854 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1196159080 X:112462565-112462587 ATACAGGCAGGTGGCCCTCTGGG + Intergenic
1196167406 X:112551135-112551157 ATACAGGCGGGTGCCTCTCTGGG - Intergenic
1198571356 X:137960422-137960444 ATACAGCCGGGTGCCCCTCTGGG + Intergenic
1198572416 X:137971732-137971754 ATACAGGCAGGTGCCCCTCTGGG + Intergenic
1198725762 X:139675700-139675722 ATACAGGCAGGTGCCCCTCTGGG - Intronic
1199181056 X:144854382-144854404 ATACAGGCGGGTGCCCCTCTGGG + Intergenic
1199292403 X:146119600-146119622 ATACAGACAGGTGTCCCTCTTGG + Intergenic
1199524823 X:148781128-148781150 AATCTGGCGGGTGCCCTTCTGGG - Intronic
1200172931 X:154091686-154091708 TTTCAGGAGGGTGTCCTTCTAGG + Intronic
1200371341 X:155728193-155728215 ATACAGGCAGGTGCCCCTCTGGG - Intergenic
1200650310 Y:5833002-5833024 ATACAAGCGGGTGCCCCTCTGGG + Intergenic
1201314380 Y:12629474-12629496 ATACAGGTGGGTGCCCCTCTGGG - Intergenic
1201333425 Y:12852913-12852935 ATATAGGCGGGTGCCCCTCTGGG - Intronic