ID: 1027117996

View in Genome Browser
Species Human (GRCh38)
Location 7:75496212-75496234
Sequence TTGTGCTTCTAGAAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027117996_1027118000 -3 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118000 7:75496232-75496254 CAAAAATGAGCTGGGCGTTCTGG No data
1027117996_1027118004 25 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118004 7:75496260-75496282 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1027117996_1027118001 0 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data
1027117996_1027118002 1 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118002 7:75496236-75496258 AATGAGCTGGGCGTTCTGGTGGG No data
1027117996_1027118006 28 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118006 7:75496263-75496285 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1027117996_1027118003 24 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118003 7:75496259-75496281 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027117996 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr