ID: 1027118001

View in Genome Browser
Species Human (GRCh38)
Location 7:75496235-75496257
Sequence AAATGAGCTGGGCGTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027117994_1027118001 19 Left 1027117994 7:75496193-75496215 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data
1027117993_1027118001 23 Left 1027117993 7:75496189-75496211 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data
1027117995_1027118001 14 Left 1027117995 7:75496198-75496220 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data
1027117997_1027118001 -1 Left 1027117997 7:75496213-75496235 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data
1027117996_1027118001 0 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118001 7:75496235-75496257 AAATGAGCTGGGCGTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027118001 Original CRISPR AAATGAGCTGGGCGTTCTGG TGG Intergenic
No off target data available for this crispr