ID: 1027118003

View in Genome Browser
Species Human (GRCh38)
Location 7:75496259-75496281
Sequence CACCTGTAATCCCAGCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 794039
Summary {0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027117996_1027118003 24 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118003 7:75496259-75496281 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1027117997_1027118003 23 Left 1027117997 7:75496213-75496235 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1027118003 7:75496259-75496281 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027118003 Original CRISPR CACCTGTAATCCCAGCTACT TGG Intergenic
Too many off-targets to display for this crispr