ID: 1027118004

View in Genome Browser
Species Human (GRCh38)
Location 7:75496260-75496282
Sequence ACCTGTAATCCCAGCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1154836
Summary {0: 15366, 1: 98640, 2: 233329, 3: 337639, 4: 469862}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027117996_1027118004 25 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118004 7:75496260-75496282 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1027117997_1027118004 24 Left 1027117997 7:75496213-75496235 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1027118004 7:75496260-75496282 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027118004 Original CRISPR ACCTGTAATCCCAGCTACTT GGG Intergenic
Too many off-targets to display for this crispr