ID: 1027118006

View in Genome Browser
Species Human (GRCh38)
Location 7:75496263-75496285
Sequence TGTAATCCCAGCTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1343165
Summary {0: 48952, 1: 142577, 2: 242332, 3: 522592, 4: 386712}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027117997_1027118006 27 Left 1027117997 7:75496213-75496235 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1027118006 7:75496263-75496285 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1027117996_1027118006 28 Left 1027117996 7:75496212-75496234 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1027118006 7:75496263-75496285 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027118006 Original CRISPR TGTAATCCCAGCTACTTGGG AGG Intergenic
Too many off-targets to display for this crispr