ID: 1027125967

View in Genome Browser
Species Human (GRCh38)
Location 7:75556936-75556958
Sequence CCACACCCTGCACTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027125967_1027125980 30 Left 1027125967 7:75556936-75556958 CCCCAAAAAAGTGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 309
Right 1027125980 7:75556989-75557011 AAAATGTGGAATGTCAAGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 358
1027125967_1027125979 26 Left 1027125967 7:75556936-75556958 CCCCAAAAAAGTGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 309
Right 1027125979 7:75556985-75557007 ACTGAAAATGTGGAATGTCAAGG 0: 1
1: 0
2: 1
3: 17
4: 230
1027125967_1027125977 16 Left 1027125967 7:75556936-75556958 CCCCAAAAAAGTGCAGGGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 309
Right 1027125977 7:75556975-75556997 CCCAGAGTGTACTGAAAATGTGG 0: 1
1: 0
2: 1
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027125967 Original CRISPR CCACACCCTGCACTTTTTTG GGG (reversed) Intronic
901042777 1:6375493-6375515 CCACACCCAGCTAATTTTTGGGG - Intronic
901570523 1:10156393-10156415 CCACACCCAGCTAATTTTTGTGG + Intronic
901598999 1:10407788-10407810 CCACACCCAGCTCATTTTTTTGG - Intronic
902261612 1:15229401-15229423 CCACACCCAGCTAATTTTTGTGG - Intergenic
903089583 1:20899826-20899848 CCACAGCTTTCACTTTTTTTAGG + Exonic
903247000 1:22023514-22023536 CCACGCCCAGCCTTTTTTTGAGG - Intergenic
904555863 1:31363624-31363646 CCACACCCTGCTAATTTTTATGG - Intronic
904739452 1:32662039-32662061 CCACACCCAGCTAATTTTTGTGG + Intronic
905180464 1:36162344-36162366 CTGCACCCTTCACTTTTGTGGGG + Intronic
905415682 1:37802333-37802355 CCACACCCTGCTAATTTTTTTGG - Intergenic
907254804 1:53170840-53170862 CCACACCCAGCTAATTTTTGTGG - Intergenic
908280254 1:62526093-62526115 CCACGCCCGGCTATTTTTTGTGG + Intronic
910658458 1:89643245-89643267 CCACACCCAGCTATTTTTTGTGG + Intronic
912394028 1:109325843-109325865 CCACACCCAGCTAATTTTTGTGG - Intronic
912518476 1:110230183-110230205 CCCCACCCTGCAGTGGTTTGTGG + Intronic
915005946 1:152636363-152636385 CCACACCCAGCTAATTTTTGTGG - Intergenic
915214801 1:154332803-154332825 CAACTCCCTGGACTGTTTTGGGG + Intronic
919283925 1:195528429-195528451 CCAATCCCTGGTCTTTTTTGAGG - Intergenic
919570491 1:199242655-199242677 TCACACCCTTGCCTTTTTTGGGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
919888286 1:201950956-201950978 CCACACCCGGCTAGTTTTTGTGG - Intergenic
922479296 1:225927728-225927750 CCACAAACTGTTCTTTTTTGTGG + Intergenic
922508153 1:226139154-226139176 CCGCACCCCCCACTTTTTTTTGG - Intergenic
924148725 1:241105345-241105367 CAACACCCTGCTCTTTTCTCAGG + Intronic
1063340188 10:5255661-5255683 TCTCACCCTGGACTTTTTTTTGG - Intergenic
1064204173 10:13309135-13309157 CCACACCCAGCAGTCTTTTTTGG - Intergenic
1064759323 10:18602216-18602238 CCACACCCAGCTAATTTTTGTGG + Intronic
1066963331 10:42240968-42240990 CCACACCCAGCTAATTTTTGCGG + Intergenic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1068117278 10:52749142-52749164 CCACACACTCCACTTCTTTTAGG - Intergenic
1069063363 10:63916939-63916961 CCAAACCAAGCAGTTTTTTGAGG - Intergenic
1069085194 10:64130513-64130535 CCACACCCTGTACTATGTAGGGG + Intergenic
1069784074 10:70976960-70976982 CCACACACTGCCCCTTTTGGAGG - Intergenic
1071120929 10:82278009-82278031 CCACACACTACACATCTTTGAGG + Intronic
1073761523 10:106633835-106633857 CAAGACCCAGCACTGTTTTGAGG + Intronic
1075214340 10:120519107-120519129 CCACTGACTGCACTTTCTTGTGG + Intronic
1075763665 10:124875946-124875968 CCAGCTCCTGTACTTTTTTGAGG + Intergenic
1077676741 11:4201399-4201421 TCCCACCCTGCACTTTCTGGCGG + Intergenic
1077978545 11:7275322-7275344 CCACACCCACCACTTCTCTGAGG + Intronic
1079357697 11:19743639-19743661 CTAAGCCCAGCACTTTTTTGTGG - Intronic
1080277703 11:30521797-30521819 CCACATCCTGCATTCTTCTGCGG - Intronic
1080526842 11:33130871-33130893 CCACACCCGGCTAATTTTTGTGG - Intronic
1081626880 11:44661378-44661400 CCACACCCTGCAAGTACTTGGGG - Intergenic
1081640360 11:44749110-44749132 CCACACCCTGCAGTCTTGAGTGG + Intronic
1083929062 11:65829331-65829353 CCATGTCCTGAACTTTTTTGGGG - Intronic
1084318908 11:68362533-68362555 CCACACCCAGCTAATTTTTGGGG - Intronic
1088108687 11:106235536-106235558 CCATACGGTGCACCTTTTTGGGG - Intergenic
1089441992 11:118525166-118525188 CCTCAATCTGCACTTTTGTGCGG - Exonic
1089482714 11:118820274-118820296 CCACACCCGGCTAATTTTTGTGG + Intergenic
1090879780 11:130823505-130823527 CCATCCCCTGCACCTTGTTGAGG + Intergenic
1091097347 11:132836802-132836824 CCACCCCCTGCTCTTTTCCGTGG - Intronic
1091841800 12:3626955-3626977 CCACACCATGCAATGTTTGGGGG - Intronic
1092200217 12:6577264-6577286 CCACACCCAGCTGTTTTTTTTGG - Intronic
1092788244 12:12049351-12049373 ACACATCCTGCAATTTATTGAGG - Intergenic
1093120757 12:15268213-15268235 CCACACCCTGCTAATTTTTTGGG + Intronic
1095651120 12:44610542-44610564 CCACATCCTGGGCATTTTTGTGG - Intronic
1097297325 12:57980728-57980750 CCACACCCAGCTAATTTTTGTGG - Intergenic
1097726291 12:63079197-63079219 CCCCACCCTGCCCCTTTTTCTGG + Intergenic
1099052345 12:77795406-77795428 CTTCACCTTGCACTTTTATGTGG - Intergenic
1099562728 12:84198180-84198202 CCACACACTGGAGTTTTTTGGGG + Intergenic
1101219696 12:102625774-102625796 CCCCTCCCTTCCCTTTTTTGAGG + Intergenic
1101361284 12:104029859-104029881 CAACCCCCATCACTTTTTTGAGG - Intronic
1102104803 12:110312188-110312210 CCACCCCCCGAACTTTTTTTGGG - Intronic
1103447215 12:121002066-121002088 GCAGACCCTGCCCTTGTTTGGGG + Exonic
1103588925 12:121976751-121976773 CCACACCGGGCAATTTTTTGGGG - Intronic
1103783195 12:123413203-123413225 CCGCACCCGGCTTTTTTTTGGGG - Exonic
1105777733 13:23678608-23678630 CCACACCCGGCTAATTTTTGTGG + Intergenic
1106039532 13:26076437-26076459 CCACACTTGGCAATTTTTTGGGG - Intergenic
1109302919 13:60608062-60608084 CCACCCCCAGCAATTGTTTGGGG - Intergenic
1109555711 13:63972940-63972962 CCACACCCAGCTAATTTTTGTGG + Intergenic
1111984155 13:95049041-95049063 CCACACCCTGCTCGTTTTTTGGG - Intronic
1112522131 13:100105684-100105706 CCACACCCAGCTAATTTTTGTGG - Intronic
1114793790 14:25689059-25689081 CCACACCCTGCTAACTTTTGTGG + Intergenic
1117296731 14:54387138-54387160 GCACACCCTGTACTTCTTAGGGG + Intergenic
1117579473 14:57137747-57137769 CCACCCCCCGCCCCTTTTTGTGG + Intergenic
1117682256 14:58216278-58216300 CCACACCCAGCTAATTTTTGGGG + Intronic
1118126214 14:62907593-62907615 CCAGACCCTGCAGTCATTTGTGG - Intronic
1119685010 14:76624471-76624493 CCAGTCCTTGCACTTTTCTGGGG + Intergenic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1120599630 14:86485727-86485749 CCATTCCCTACATTTTTTTGTGG + Intergenic
1121874822 14:97441622-97441644 CCACACCCTGTACATCTTTTGGG - Intergenic
1123026844 14:105429022-105429044 CCTCACCTTGCACTTTTATGTGG + Intronic
1123441726 15:20296439-20296461 CCACACCCAGCTAATTTTTGCGG - Intergenic
1123508331 15:20969276-20969298 GCACTCCCAGCACTTTTTTAAGG + Intergenic
1123565552 15:21543025-21543047 GCACTCCCAGCACTTTTTTAAGG + Intergenic
1123601815 15:21980312-21980334 GCACTCCCAGCACTTTTTTAAGG + Intergenic
1124111528 15:26794349-26794371 CCACACCTTACACTGTTCTGTGG + Intronic
1124619474 15:31265675-31265697 CCAGACCCTGCCCTGTTTGGTGG - Intergenic
1127990768 15:64114630-64114652 CCTCACCATTCACTCTTTTGAGG - Intronic
1128635191 15:69298580-69298602 CCACCCCATGCACTTTTCCGAGG + Intergenic
1130084640 15:80767137-80767159 CCACACCCGGCTACTTTTTGTGG - Intergenic
1131550207 15:93350755-93350777 CCACACACTTCACTGGTTTGGGG - Intergenic
1131733033 15:95302030-95302052 CCACACCCAGCTAATTTTTGCGG - Intergenic
1202973923 15_KI270727v1_random:270118-270140 GCACTCCCAGCACTTTTTTAAGG + Intergenic
1132737765 16:1395545-1395567 CCATACCCTGCACCTTCTAGTGG + Intronic
1134027111 16:10962901-10962923 CCACACCCAGCTAATTTTTGTGG - Intronic
1135186666 16:20321725-20321747 CCACACCCTGCTCTCATTTTAGG - Intronic
1135356259 16:21771727-21771749 CCACAACCTCCAAGTTTTTGGGG - Intergenic
1135454750 16:22587866-22587888 CCACAACCTCCAAGTTTTTGGGG - Intergenic
1135996420 16:27252761-27252783 CCACACCCGGCTAATTTTTGTGG - Intronic
1136719472 16:32309072-32309094 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136724501 16:32347474-32347496 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136837845 16:33515352-33515374 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136842828 16:33553514-33553536 CCACACCCAGCTAATTTTTGCGG + Intergenic
1137391645 16:48086294-48086316 CCACACCCTTCTGTTTTCTGTGG + Intronic
1137586478 16:49666878-49666900 TCCCACCCTGCCCTTTTTTCTGG - Intronic
1137590939 16:49693249-49693271 CCACACCCTGCTCATTTCTGTGG - Intronic
1139456816 16:67086174-67086196 CCACACCATGCCCTTTCTTTCGG + Intronic
1139787895 16:69408653-69408675 CCACACCCTGCACGTGGTTCTGG - Intergenic
1139790483 16:69430369-69430391 CCACACCCTGCTAATTTTTTTGG + Intronic
1140143019 16:72277459-72277481 TCACACCCTGAGCTTTTTTAGGG - Intergenic
1140927464 16:79598558-79598580 CCACACCCTGCTCGAGTTTGTGG - Intronic
1141267071 16:82507189-82507211 GCACACCCTGGACGTTTCTGAGG + Intergenic
1142284185 16:89165053-89165075 CCACACCCTGCCCTTTGGGGGGG - Intergenic
1203001929 16_KI270728v1_random:170281-170303 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203006959 16_KI270728v1_random:208697-208719 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203133533 16_KI270728v1_random:1706687-1706709 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203148028 16_KI270728v1_random:1815636-1815658 CCACACCCAGCTAATTTTTGCGG + Intergenic
1203152993 16_KI270728v1_random:1853812-1853834 CCACACCCAGCTAATTTTTGCGG + Intergenic
1142647302 17:1322925-1322947 CCACACCCAGCTAATTTTTGGGG + Intergenic
1143351425 17:6290960-6290982 CCCCACCCTACACTCTTCTGAGG - Intergenic
1143819450 17:9547944-9547966 CCACACCCAGCTAATTTTTGTGG + Intronic
1146859646 17:36285978-36286000 CCACACCTGGCTCATTTTTGTGG + Intronic
1147089970 17:38090065-38090087 CCACACCTGGCTCATTTTTGTGG + Intergenic
1147107241 17:38230456-38230478 CCACACCTGGCTCATTTTTGTGG - Intergenic
1148062355 17:44845641-44845663 CCACACCCAGCTAGTTTTTGGGG - Intergenic
1148083413 17:44979894-44979916 CCACACCCTGGCCTGATTTGAGG + Intergenic
1148156449 17:45427585-45427607 CCCTACCCTGGACTTTGTTGGGG + Intronic
1150093507 17:62351578-62351600 CCACACCCAGCTAATTTTTGTGG + Intergenic
1150288701 17:63968993-63969015 CCACACCCAGCTCATTTTTTTGG + Intronic
1150388123 17:64776216-64776238 CCCTACCCTGGACTTTGTTGGGG + Intergenic
1150664837 17:67123875-67123897 CCCCACCCTCCTCTTTCTTGTGG + Intronic
1151241156 17:72758946-72758968 CCACACCCGGCTAATTTTTGTGG - Intronic
1151630429 17:75307457-75307479 CCACACCCGGCTAATTTTTGTGG + Intergenic
1152118590 17:78404131-78404153 CCACCCCCTGCCCATGTTTGTGG - Intronic
1152846510 17:82603207-82603229 CCACACGCTGCGCTTTGCTGCGG - Exonic
1153673378 18:7434150-7434172 GCACACTCTGTACTTTTTTTGGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155699619 18:28727499-28727521 CCACACCCAGCTAATTTTTGTGG - Intergenic
1159589202 18:70314098-70314120 CCACACCCGGCTAATTTTTGTGG - Intronic
1160456423 18:79005602-79005624 CCACACCCTGCTAATTTTTTGGG + Intergenic
1161582559 19:5088672-5088694 CCACAACCTGCTCTTTTGCGGGG - Intronic
1162156207 19:8679514-8679536 CCTCACCCTGCACACATTTGTGG - Intergenic
1162240964 19:9354064-9354086 CCACACCCGGCATGTGTTTGTGG + Intronic
1162557930 19:11399270-11399292 ACCCAGCCTACACTTTTTTGAGG - Intronic
1163787840 19:19285719-19285741 CCACACCCGGCTAATTTTTGTGG + Intronic
1163788321 19:19289590-19289612 CCACACCCTGCTAATTTTTTTGG - Intronic
1165336337 19:35172635-35172657 CCAAACCCTGCAGTTTCTTTGGG - Intergenic
1166638421 19:44472568-44472590 CCACACTCTTCACTTTTATAGGG - Intergenic
1166803864 19:45473473-45473495 CCACACCCACCCTTTTTTTGGGG + Exonic
1167402070 19:49279520-49279542 CCAGACCCTTCAGTGTTTTGGGG - Intergenic
1168050294 19:53824750-53824772 CCACACCCAGCTAATTTTTGTGG + Intergenic
925191745 2:1890521-1890543 CCTCACCCTGTACCTCTTTGGGG - Intronic
926880273 2:17537975-17537997 TCACACCCTGGATTTTTTTTGGG - Intergenic
928318809 2:30266972-30266994 CCACACCCTTCACTGGTGTGTGG - Intronic
928508876 2:31983103-31983125 CCACACCCAGCTAATTTTTGTGG - Intronic
930065927 2:47327587-47327609 CCACACCGGCCAATTTTTTGTGG - Intergenic
930339828 2:50098327-50098349 CCACTCCCTCAACTCTTTTGTGG - Intronic
931386322 2:61800957-61800979 CCACACCCAGCTAATTTTTGTGG + Intergenic
932785421 2:74597478-74597500 CCACCCCCAGCCCTTTTTTCTGG + Intronic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
935220755 2:101010416-101010438 CCACACACTTCACATCTTTGAGG - Intronic
935632840 2:105226075-105226097 CCACACCCAGCTAATTTTTGTGG - Intergenic
937973108 2:127565280-127565302 CCACACCCTGGACTGAGTTGGGG - Exonic
938025726 2:127946244-127946266 CCACAGCCTCCACTGTTATGGGG - Intronic
940015339 2:149098844-149098866 CCACATCCTGCACTTTTACAAGG + Intronic
941013492 2:160328486-160328508 CCACACCAAACACTTTTTGGGGG - Intronic
941517022 2:166492567-166492589 ACACACTTTTCACTTTTTTGAGG + Intronic
942262097 2:174176726-174176748 CCATACCTCCCACTTTTTTGTGG - Intronic
943754759 2:191546215-191546237 CCACACCCTGCTAATTTTTTTGG + Intergenic
944145737 2:196505382-196505404 CCACACCCAGCTAATTTTTGTGG - Intronic
945283379 2:208058741-208058763 ACACACCCCGGACTGTTTTGGGG + Intergenic
945530576 2:210949541-210949563 TCACACCCAGCACTTTTGGGAGG + Intergenic
946993153 2:225359064-225359086 CCACACCCAGCGAATTTTTGTGG + Intergenic
947381548 2:229550146-229550168 CCACACCCAGCTAATTTTTGTGG + Intronic
947561210 2:231154128-231154150 CAACAGCCTGTACTTTTTTTTGG - Intronic
948500581 2:238390244-238390266 CCACCCACGGCACCTTTTTGTGG - Intronic
948984342 2:241510988-241511010 CCACACCCAGCTAATTTTTGTGG + Intergenic
1169508435 20:6238885-6238907 CCACACCCTGGAATTTTCTGAGG - Intergenic
1169511171 20:6265772-6265794 CCACTCGATGAACTTTTTTGAGG + Intergenic
1170797986 20:19566393-19566415 CCACACCCTGCTGTTTCCTGTGG + Intronic
1170994603 20:21340137-21340159 CCACACCCGGCTAATTTTTGTGG - Intronic
1172591180 20:36119300-36119322 CCACACCTTGCCCTTTCTTTTGG - Intronic
1178176224 21:30102733-30102755 CCCCACCCTGCTCTTTCCTGAGG + Intergenic
1178403102 21:32304107-32304129 TCAAACCCTGCACTATTTTTAGG + Intronic
1178433530 21:32537129-32537151 CCACATTGTGCACTTTTCTGGGG + Intergenic
1178976661 21:37226551-37226573 CCACACCCTCCACCCTTCTGGGG - Intronic
1179170627 21:38970298-38970320 GCACCCCCTTCACTTTTTTGTGG + Intergenic
1179266435 21:39807594-39807616 CCACACTCTGCATTTTGTAGAGG - Intergenic
1179768929 21:43598358-43598380 CCACACCCGGCTAATTTTTGTGG + Intronic
1180309902 22:11160120-11160142 CCACACCCAGCTAATTTTTGCGG - Intergenic
1180548379 22:16521930-16521952 CCACACCCAGCTAATTTTTGCGG - Intergenic
1180789106 22:18564600-18564622 CCACACCCAGCTGATTTTTGTGG + Intergenic
1181232633 22:21430712-21430734 CCACACCCAGCTAATTTTTGTGG - Intronic
1181246018 22:21504145-21504167 CCACACCCAGCTAATTTTTGTGG + Intergenic
1181279044 22:21705494-21705516 CCATGCCCAGCCCTTTTTTGGGG + Intronic
1182211073 22:28678368-28678390 CCACACCCAGCTAATTTTTGCGG + Intronic
1182690698 22:32159523-32159545 CCAACCCCTGCACTTTTCTCAGG - Intergenic
1183192259 22:36329193-36329215 CCACACCCTGCTCTCTGATGTGG + Intronic
1184721271 22:46315042-46315064 CCACACCCGGCTAATTTTTGTGG + Intronic
1185189907 22:49428618-49428640 CCACACCTGGCTTTTTTTTGGGG + Intronic
952573079 3:34741238-34741260 CCACCCCTTGAACTTTTTAGTGG + Intergenic
952716061 3:36482265-36482287 CCACACCCTGCCCTCTTATTAGG + Intronic
953381298 3:42474623-42474645 CCACACCCTGGGCTCTGTTGGGG - Intergenic
954361341 3:50124333-50124355 CCCCACCCTGCAGATTTTTCTGG + Intergenic
955774760 3:62421241-62421263 CCACACCCCCCACCCTTTTGAGG + Intronic
956313486 3:67907857-67907879 CCTCGCCCAGCACTTTTCTGTGG + Intergenic
956584474 3:70849976-70849998 ACACACCCTTCACTTATTTGGGG + Intergenic
956717883 3:72094251-72094273 CCACAAACTGCACTTATTTAGGG + Intergenic
960961203 3:123071719-123071741 CCACACCTTGCTCTTTCCTGGGG - Intronic
961032042 3:123614797-123614819 TCACACCTTTCACTTTTTGGGGG + Intronic
961480523 3:127176615-127176637 CCACTTACTGCACTTTTATGAGG + Intergenic
961668434 3:128508877-128508899 CCAACCCCTGCACCCTTTTGTGG + Intergenic
961861618 3:129921011-129921033 ACACACCCTGCACTTGGCTGTGG - Intergenic
962717672 3:138141159-138141181 CCACATCCTGCACTTATTTTGGG - Intergenic
963296209 3:143549509-143549531 CCCCACACTGCCTTTTTTTGGGG - Intronic
965346186 3:167553808-167553830 CCACACACTGCCCTATTTTTAGG - Intronic
966234209 3:177682710-177682732 CCCCTCCCTGTACTTTTTTTTGG + Intergenic
967027213 3:185575454-185575476 CCACTCCCTGCCCTGTTTTCAGG - Intergenic
967984115 3:195082691-195082713 CCACACCCGGCTAATTTTTGTGG - Intronic
968340878 3:197954487-197954509 CCACACCCAGCTAATTTTTGGGG + Intronic
968398988 4:271586-271608 CCACACTCTTCACATTTGTGGGG + Exonic
968694228 4:2014044-2014066 CCACACCCAGCCTATTTTTGTGG + Intronic
969351298 4:6599506-6599528 CCACACCCGGCTCATTTTTTTGG - Intronic
972433469 4:39007608-39007630 CCACACCCAGCTCATTTTTTTGG + Intronic
973379213 4:49308841-49308863 CCACATTCTGCGTTTTTTTGGGG - Intergenic
973385410 4:49510625-49510647 CCACATTCTGCGTTTTTTTGGGG + Intergenic
974054041 4:56967864-56967886 CAAGACCTAGCACTTTTTTGGGG + Intronic
975871531 4:78784402-78784424 CCACAGCCTGCTATTTTTAGGGG + Intronic
976712173 4:88084366-88084388 GCACACCCTGGACTTTTTGAGGG + Intergenic
977890004 4:102298834-102298856 CTAATCCCTGAACTTTTTTGAGG - Intronic
980008254 4:127565943-127565965 CCACACCCTGCTAATTTTTTTGG - Intergenic
980027156 4:127781397-127781419 CCACACTGGGCTCTTTTTTGAGG + Intergenic
982324973 4:154120835-154120857 CCACACTATGAACTTTTTTTTGG + Intergenic
982760714 4:159279832-159279854 CCACACCCAGCTAATTTTTGTGG + Intronic
983085607 4:163440725-163440747 CCACACCCAGCTAGTTTTTGTGG - Intergenic
983223409 4:165064405-165064427 CCACACCTGGCAACTTTTTGGGG + Intergenic
984038607 4:174700943-174700965 CTTCACCTTGCACTTTTATGTGG - Intronic
988715072 5:33817616-33817638 CCACATCCTGGATTATTTTGTGG + Intronic
989519203 5:42381128-42381150 CCAAACCCAGCACTTTCCTGTGG + Intergenic
990982464 5:61614459-61614481 CCACACCCAGCTAATTTTTGTGG + Intergenic
992019706 5:72610152-72610174 CCACACCCAGGAATTTTTTTTGG - Intergenic
992958732 5:81937864-81937886 CCACACCCGGCTAATTTTTGTGG + Intergenic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
998508571 5:142692179-142692201 CCACACCCAGCTAATTTTTGTGG - Intronic
998931803 5:147189348-147189370 ACACACCCAGCACTTTTCTAAGG - Intergenic
998984148 5:147736589-147736611 CAAAACCCTGTACTTTTATGAGG + Intronic
998984156 5:147736665-147736687 CAAAACCCTGTACTTTTATGAGG + Intronic
999178688 5:149652967-149652989 GCACATCATGCACTTTTTTTTGG + Intergenic
1000670735 5:164059980-164060002 CCAATCCCTGCACTATTTTCAGG - Intergenic
1001561996 5:172675942-172675964 CCAGGCCCTGTGCTTTTTTGAGG + Intronic
1002872454 6:1179171-1179193 CCACTCCCAGCCCTTTTTGGGGG - Intergenic
1003218726 6:4137467-4137489 CCACACCCCACTCTTTTCTGTGG - Intergenic
1003542936 6:7033868-7033890 CCACACCCAGCTAATTTTTGTGG - Intergenic
1004206446 6:13595834-13595856 CCACACCCAGCTAATTTTTGTGG - Intronic
1006970686 6:38041989-38042011 CCACACACGGCTTTTTTTTGGGG + Intronic
1007217392 6:40250929-40250951 CCCCACCCTGCCCCTTTCTGAGG + Intergenic
1009903825 6:69843508-69843530 CCACACCCTTGACTTTGATGAGG + Intergenic
1010387075 6:75292947-75292969 CCACACCATGAATTTTTTTATGG + Intronic
1010969828 6:82251531-82251553 CCTCACCCTGCTTTCTTTTGGGG - Intergenic
1011925942 6:92644865-92644887 CCTCCCCCTCCACTTTTTTTCGG + Intergenic
1013522776 6:110947983-110948005 CCACACCCAGCTATTTTTAGTGG - Intergenic
1014244749 6:119055885-119055907 CCACAATCTCCACTTTTCTGGGG + Intronic
1018134425 6:160765934-160765956 GAAAACACTGCACTTTTTTGTGG - Intergenic
1018916769 6:168137211-168137233 CCACACCCTGCACAAGTATGTGG - Intergenic
1019067314 6:169313216-169313238 CCACACTCTGAACCTTTGTGCGG + Intergenic
1019991646 7:4695958-4695980 CCACACCCAGCTAATTTTTGTGG - Intronic
1020794932 7:12667673-12667695 CCACACTCTGCTCTTTTTCCTGG - Intergenic
1021443685 7:20709917-20709939 CCACACCCAGCTAATTTTTGTGG - Intronic
1021533774 7:21679524-21679546 CCACCCCCTGGGCTTTATTGAGG - Intronic
1023213584 7:37834400-37834422 CCACACCAGGCTATTTTTTGTGG + Intronic
1023939525 7:44760710-44760732 CCACACCCAGCCCTTTTCTTAGG - Intronic
1025817335 7:64927243-64927265 CCACACCCGGCTAATTTTTGTGG + Intronic
1025974146 7:66356379-66356401 CCACACCCAGCATTTTTATTGGG + Intronic
1026518063 7:71089882-71089904 CCACACCCGGCTAATTTTTGTGG - Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1028548907 7:92034654-92034676 CCACACCCAGCTAATTTTTGTGG + Intronic
1030090468 7:105853606-105853628 CCACGCCCAGCTCATTTTTGTGG - Intronic
1030564617 7:111137978-111138000 CCACACCCAGCTAATTTTTGTGG + Intronic
1030587249 7:111435836-111435858 CCAGACCCTTCAGTGTTTTGGGG + Intronic
1031597289 7:123662795-123662817 TCACAGTCTGGACTTTTTTGGGG - Exonic
1032035160 7:128516165-128516187 CCACACCCAGCTAATTTTTGTGG - Intergenic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1034113002 7:148556905-148556927 CCCCACCCTCCACTCTTTAGTGG + Intergenic
1034512926 7:151551083-151551105 CCACACCAGGCACTGTTCTGGGG - Intergenic
1034978230 7:155460033-155460055 CCAAACCCTCAACTATTTTGCGG + Intronic
1037276971 8:17191115-17191137 CCACGCCCGGCTATTTTTTGTGG + Intronic
1037944043 8:22975331-22975353 CCACAGCCTGCAGTCTTTTCTGG - Intronic
1038267037 8:26045625-26045647 CCACACCCTGCACTGACTTAGGG + Intergenic
1039084572 8:33767149-33767171 CCCCTCCCTCCACTTTTTTTTGG + Intergenic
1042139617 8:65664750-65664772 CCATACCCGGCTATTTTTTGTGG + Intronic
1043595023 8:81875250-81875272 CCACACCCAGCTCATTTGTGTGG + Intergenic
1045145587 8:99340517-99340539 CCACCCCCTTCACATTTATGGGG - Intronic
1045261251 8:100576739-100576761 ACACCCCTTGCACTTTTTGGAGG - Intronic
1045764546 8:105651310-105651332 CCACACCCGGCTAATTTTTGTGG - Intronic
1048338546 8:133521287-133521309 CCACACCCAGCTAATTTTTGGGG + Intronic
1049331928 8:142059227-142059249 CCGCACCCTGCAGTTTGGTGTGG - Intergenic
1050970135 9:11860192-11860214 CCACACACTGGACTTAATTGGGG - Intergenic
1053127541 9:35594986-35595008 CCACACCCAGCTAATTTTTGGGG + Intergenic
1055323272 9:75102678-75102700 CCAGACCCTGCTCTTTATTCTGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059914701 9:119085972-119085994 CCACACCCAGCTAATTTTTGTGG - Intergenic
1060175062 9:121491558-121491580 ACACGCTCTGCACTTCTTTGTGG + Intergenic
1061000282 9:127898993-127899015 CCACACCCTGCCCTCTGTTTGGG + Intronic
1061690256 9:132321690-132321712 CCACACCCGGCTAATTTTTGTGG - Intronic
1061826518 9:133261436-133261458 CCGCACCATGCACTTTTTGGAGG - Intronic
1062085261 9:134644987-134645009 CCACTCACTGCTCTTTTATGGGG - Intronic
1062330212 9:136038382-136038404 CCACACCCAGCTAATTTTTGTGG - Intronic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1203700201 Un_GL000214v1:128780-128802 CCACATTCTGCGTTTTTTTGAGG - Intergenic
1203701115 Un_GL000214v1:134764-134786 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1203480904 Un_GL000224v1:9640-9662 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1203570496 Un_KI270744v1:124999-125021 CCACATTCTGCGTTTTTTTGGGG - Intergenic
1186211275 X:7252993-7253015 CCACACCCAGCTAATTTTTGTGG - Intronic
1187153521 X:16703178-16703200 CCACGCCCTGCTAATTTTTGTGG + Intronic
1190441091 X:50475046-50475068 CCACACTTTGTACTTTTCTGGGG + Intergenic
1193062119 X:77218011-77218033 TGACATCATGCACTTTTTTGAGG + Intergenic
1193130333 X:77913056-77913078 CCACAACCTTCACTTCTGTGAGG + Intronic
1198212072 X:134525635-134525657 CCACACCCAGCTAATTTTTGTGG - Intergenic
1198261773 X:134971132-134971154 CCACACCCAGCTTTTTTTTGGGG - Intergenic
1198526279 X:137504200-137504222 CTACACCCTGCAAATTTATGAGG + Intergenic
1199685224 X:150259495-150259517 CAACACCCTTAACTTTTCTGGGG + Intergenic
1199943695 X:152649032-152649054 TGACACCCTGCAGTTTTCTGAGG + Intronic
1200860875 Y:7991018-7991040 CCACACTCTTCACATTTTTGGGG + Intergenic