ID: 1027126420

View in Genome Browser
Species Human (GRCh38)
Location 7:75559726-75559748
Sequence GCTCACTTTCTATCTCAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 309}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027126403_1027126420 8 Left 1027126403 7:75559695-75559717 CCCCCGGGGCCCGCCCCCGCCCC 0: 1
1: 2
2: 41
3: 332
4: 2007
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126408_1027126420 -2 Left 1027126408 7:75559705-75559727 CCGCCCCCGCCCCCACCCACCGC 0: 1
1: 5
2: 103
3: 769
4: 5530
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126405_1027126420 6 Left 1027126405 7:75559697-75559719 CCCGGGGCCCGCCCCCGCCCCCA 0: 1
1: 1
2: 17
3: 189
4: 1519
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126411_1027126420 -7 Left 1027126411 7:75559710-75559732 CCCGCCCCCACCCACCGCTCACT 0: 1
1: 0
2: 4
3: 90
4: 905
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126412_1027126420 -8 Left 1027126412 7:75559711-75559733 CCGCCCCCACCCACCGCTCACTT 0: 1
1: 0
2: 7
3: 69
4: 883
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126409_1027126420 -5 Left 1027126409 7:75559708-75559730 CCCCCGCCCCCACCCACCGCTCA 0: 1
1: 1
2: 10
3: 134
4: 1309
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126400_1027126420 18 Left 1027126400 7:75559685-75559707 CCCGCGCCTGCCCCCGGGGCCCG 0: 1
1: 0
2: 3
3: 72
4: 656
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126404_1027126420 7 Left 1027126404 7:75559696-75559718 CCCCGGGGCCCGCCCCCGCCCCC 0: 1
1: 1
2: 40
3: 429
4: 2212
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126401_1027126420 17 Left 1027126401 7:75559686-75559708 CCGCGCCTGCCCCCGGGGCCCGC 0: 1
1: 0
2: 5
3: 88
4: 699
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126402_1027126420 12 Left 1027126402 7:75559691-75559713 CCTGCCCCCGGGGCCCGCCCCCG 0: 2
1: 1
2: 15
3: 190
4: 1373
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126406_1027126420 5 Left 1027126406 7:75559698-75559720 CCGGGGCCCGCCCCCGCCCCCAC 0: 1
1: 1
2: 54
3: 447
4: 2565
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126407_1027126420 -1 Left 1027126407 7:75559704-75559726 CCCGCCCCCGCCCCCACCCACCG 0: 1
1: 4
2: 65
3: 479
4: 3563
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309
1027126410_1027126420 -6 Left 1027126410 7:75559709-75559731 CCCCGCCCCCACCCACCGCTCAC 0: 1
1: 1
2: 2
3: 110
4: 1170
Right 1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027126420 Original CRISPR GCTCACTTTCTATCTCAGAC AGG Exonic
901555329 1:10027487-10027509 TCTCACTTTCTCACCCAGACTGG + Intergenic
901693876 1:10992077-10992099 GCTCACTCTGTTGCTCAGACTGG - Intergenic
905693411 1:39958601-39958623 GCTCCCTCCCTATCTCAGCCAGG - Intronic
905738081 1:40344622-40344644 ACTCAGTTTCTATTTCATACTGG - Intergenic
906370644 1:45250495-45250517 TCTCTCTTTCTTTCACAGACAGG - Intronic
908593860 1:65664361-65664383 TCTCACTTTGTCTCTCAGGCTGG + Intergenic
909442869 1:75717309-75717331 TCTCACTCTCTCTCCCAGACTGG - Intergenic
909464946 1:75963110-75963132 TCTCATTTTCTATCTAACACAGG + Intergenic
909624374 1:77699485-77699507 GCTCACTTTGTCACTCAGGCTGG - Intronic
910248367 1:85167182-85167204 TCTCACTTTGTCTCTCAGGCTGG - Intronic
915198456 1:154208206-154208228 TCTCACTTTGTTTCCCAGACTGG - Intronic
915676596 1:157537857-157537879 TCTCACTTTCCAACTCAGATTGG + Intronic
916079118 1:161221339-161221361 GCTCACTGTGTTTCTCAGTCTGG + Intergenic
916258212 1:162812477-162812499 GCTCACTATGTTTCTCAGGCTGG - Exonic
916652981 1:166847969-166847991 GCTCCCTGTCCATCTCATACTGG + Intronic
918120760 1:181537583-181537605 CCTCAACTTCTCTCTCAGACAGG - Intronic
918818811 1:189225782-189225804 GCACTCTTCATATCTCAGACGGG - Intergenic
920090798 1:203451634-203451656 GGTCATTTTGTTTCTCAGACAGG - Intergenic
920204927 1:204284346-204284368 GCTGATGTTCTCTCTCAGACTGG + Intronic
922096420 1:222446683-222446705 GCTCACTCTCTTTCCCAGGCTGG - Intergenic
922148178 1:222970027-222970049 TCTCATTTACTATCTCAGAAAGG - Intronic
923316995 1:232790224-232790246 TCTCACTTTGTTTCTCAGTCTGG + Intergenic
924024885 1:239821627-239821649 GATCACTTTCTATCCCAAAAGGG - Intronic
1064690759 10:17916408-17916430 GCTCACTTTGTTTCCCAGGCTGG + Intergenic
1065499573 10:26366152-26366174 GCTCACCTTCTATGTGTGACTGG + Intergenic
1065759285 10:28966873-28966895 TCTCACTTTGTCTCTCAGGCTGG - Intergenic
1066157061 10:32689762-32689784 TCTCACTTTCTTGCCCAGACTGG + Intronic
1066724655 10:38378164-38378186 GCTCACTATGTTTCTCAGGCTGG - Intergenic
1067009274 10:42694262-42694284 GCTCACTCTCTTGCCCAGACTGG - Intergenic
1067545329 10:47188673-47188695 GGTCAATTTCTCTCTGAGACTGG + Intergenic
1068581584 10:58746600-58746622 GCTGAGTTTCTATCCCAGACTGG + Intronic
1069466899 10:68648806-68648828 TCTCACTTTGTTACTCAGACTGG + Intronic
1070783950 10:79152468-79152490 TCTCACTTTGTAACTCAGGCTGG - Intronic
1071116257 10:82223915-82223937 ACTCACTTTGTATCTCTTACAGG - Intronic
1072323273 10:94271790-94271812 TTTCTCTTTATATCTCAGACTGG - Intronic
1072518113 10:96206519-96206541 TCTCACTTTGTAGCCCAGACTGG - Intronic
1072768047 10:98111754-98111776 TCTCACTTTCTTGCTCAGGCTGG - Intergenic
1072832681 10:98675727-98675749 TCTCACTTTCTTTCTTAGATAGG - Intronic
1074282097 10:112062363-112062385 GCTCCTTTTCTATTTAAGACAGG + Intergenic
1076808586 10:132873608-132873630 TCTCACTCTCTCTCTCAGGCTGG + Intronic
1077276191 11:1710177-1710199 GCTCACTATATTTCCCAGACTGG - Intergenic
1077605179 11:3605353-3605375 TCTCATTTTCCATCTCAGATAGG + Intergenic
1078248129 11:9595034-9595056 TCTCACTTTGTAGCCCAGACTGG + Intergenic
1079081680 11:17417752-17417774 TCTCTCTCTCTCTCTCAGACAGG + Intronic
1079204433 11:18401984-18402006 TCTCACTTTGTAGCTCAGGCTGG + Intronic
1080266609 11:30408082-30408104 ACTCACTTTCTATGTAAAACGGG - Intronic
1080608224 11:33882272-33882294 GAACACTTGCTTTCTCAGACCGG - Intronic
1082115895 11:48327949-48327971 GTACTCTTTCTTTCTCAGACTGG - Intronic
1084137119 11:67193017-67193039 TCTCACTTTGTTTCTCAGTCTGG + Intronic
1086210559 11:84313143-84313165 TCTCACTCTGTAGCTCAGACTGG + Intronic
1086670863 11:89545894-89545916 ACTCATTTTCCATATCAGACAGG - Intergenic
1088681821 11:112249925-112249947 TCTCACTTTCTCACCCAGACTGG - Intronic
1089728268 11:120502432-120502454 TCTCACTTTCTAGCCCAGTCTGG - Intergenic
1089772070 11:120810033-120810055 TCTCACTTTGTAACTCAGGCTGG - Intronic
1090035723 11:123247920-123247942 GTTCACTTTCTATCACTGCCTGG - Intergenic
1090283680 11:125480378-125480400 TCTCTCTTTTTTTCTCAGACAGG - Intronic
1091571983 12:1695045-1695067 TCTCACTCTGTATCTCAGGCTGG + Intronic
1092032755 12:5302196-5302218 TGTCACTTTCTATGTCTGACAGG - Intergenic
1092397111 12:8136532-8136554 TCTCACTTTCTGTCCCAGGCTGG - Intronic
1092511561 12:9162268-9162290 GCTCTCTTTCTACCTCATCCTGG + Intronic
1094116389 12:26919135-26919157 TCTCACTTTGTGACTCAGACTGG - Intronic
1094683307 12:32685388-32685410 TCTCACTTTCTCGCCCAGACTGG + Intronic
1097095038 12:56540401-56540423 TCTCACTTTCTGTCCCAGGCTGG + Intronic
1098341003 12:69451065-69451087 TCTCACTTTGTAGCTCAGGCTGG - Intergenic
1098434242 12:70451846-70451868 TCTCACTTTGTCACTCAGACTGG + Intergenic
1100731340 12:97473730-97473752 TCTCGCTTTCTATCTCAAATAGG + Intergenic
1100846827 12:98667799-98667821 TCTCACTTTGTTTCTCAGGCTGG + Intronic
1100976106 12:100124248-100124270 TCTCACTCTCTCTCCCAGACTGG - Intronic
1102106969 12:110333634-110333656 GTTCACATTCTGTCTCTGACAGG - Intronic
1102361768 12:112294095-112294117 TCTCACTTTATTGCTCAGACTGG + Intronic
1103513831 12:121493887-121493909 TCTCACTTTGTAGCCCAGACTGG + Intronic
1103831132 12:123780170-123780192 TCTCTCTTTCTTTCTGAGACAGG + Intronic
1104551877 12:129764743-129764765 GCTCACTTTGTTTCCCAGGCTGG - Intronic
1105006356 12:132723334-132723356 GCTCACGTTTGACCTCAGACGGG + Intergenic
1105348245 13:19593221-19593243 TCTCACTATATTTCTCAGACTGG - Intergenic
1106164612 13:27232348-27232370 TCTCACTCTATTTCTCAGACTGG + Intergenic
1110378374 13:74820689-74820711 CCTCACTCTCTATTTCAGTCAGG - Intergenic
1110438831 13:75505132-75505154 CCTCACTTTCTGTATCAGACAGG + Intergenic
1111976529 13:94971921-94971943 TCTCACTCTCTTGCTCAGACTGG - Intergenic
1113578239 13:111409675-111409697 TCTCTCTCTCTCTCTCAGACAGG - Intergenic
1113728243 13:112621250-112621272 TCTCACTCTGTCTCTCAGACTGG - Intergenic
1114465948 14:22922835-22922857 TCTCTCTTTCTGTCTCTGACAGG - Exonic
1115480345 14:33854960-33854982 TCTCACTTTCTATGGCATACAGG - Intergenic
1116254436 14:42533246-42533268 TCTCACTTTGTCTCCCAGACTGG + Intergenic
1116375059 14:44188528-44188550 GCTCTCTCTCTCTCTCAGAGAGG + Intergenic
1116659812 14:47695349-47695371 TCTCACTTTGTTTCCCAGACTGG + Intergenic
1117880150 14:60305258-60305280 GCTCACTTTATCACCCAGACTGG - Intergenic
1118348893 14:64959666-64959688 TCTCACTTTCTTGCTCAGTCTGG - Intronic
1118357657 14:65028102-65028124 CCTCCCTTCCTATCTCAGAGAGG - Intronic
1119245021 14:73097228-73097250 GCTCACTTTGTCTCCCAGGCTGG + Intronic
1120225422 14:81786084-81786106 CCTCACTTTCTCTCTCTGCCTGG + Intergenic
1121322563 14:93000944-93000966 TCTCACTTTATCTCTCAGGCTGG - Intronic
1121752347 14:96368210-96368232 TCTCACTTTGTCACTCAGACTGG + Intronic
1122606801 14:102952149-102952171 TCTCACTTTGTTTCCCAGACCGG - Intronic
1125142405 15:36424312-36424334 TCTCACTTTCTTTTTGAGACAGG - Intergenic
1126153722 15:45546065-45546087 CCTCACTTTTTTGCTCAGACTGG - Intergenic
1126816556 15:52460028-52460050 GCACTCTTTATATCTCAGACGGG + Intronic
1127242278 15:57129545-57129567 GCTCAATATATATTTCAGACAGG - Intronic
1128383036 15:67127224-67127246 GTTCACATTCGACCTCAGACAGG - Intronic
1128957689 15:71965904-71965926 TCTCACTCTCTTTCTCAGGCTGG + Intronic
1129773377 15:78217048-78217070 TCTCATTTTCTATCTGTGACTGG + Intronic
1132046905 15:98571718-98571740 TCTCACTCTCTCTCTCAGGCTGG + Intergenic
1132327788 15:100986174-100986196 GGTCTCCTTCTATCTCAGCCTGG - Intronic
1132835611 16:1951409-1951431 TCTCACTTTCTCTCCCAGGCTGG + Intronic
1133573187 16:7062286-7062308 TCTCACTCTGTCTCTCAGACTGG - Intronic
1133890361 16:9873503-9873525 TCTCACTTTGTTTCTCAGGCTGG - Intronic
1133946636 16:10354580-10354602 GCTCACTTTGTTACTCAGGCTGG - Intronic
1134080000 16:11318593-11318615 GCTCACTATGTTTCTGAGACTGG + Intronic
1134368016 16:13597232-13597254 TCTCTCTCTCTGTCTCAGACAGG - Intergenic
1135202876 16:20454207-20454229 GTTCTCTTTATTTCTCAGACCGG + Intronic
1135216221 16:20573659-20573681 GTTCTCTTTATTTCTCAGACCGG - Intronic
1135235283 16:20749572-20749594 GCTCAGTTTCTCACTCAGCCAGG - Intronic
1135541849 16:23336080-23336102 TCTCACCTACTAGCTCAGACGGG - Intronic
1137013721 16:35351082-35351104 GCTCTTTTTCTTTCTCTGACTGG - Intergenic
1137533775 16:49301541-49301563 GTTCACTTTGTATCTCACTCTGG + Intergenic
1137726836 16:50662373-50662395 GATCACTTCCTATCCCAGACAGG + Intergenic
1138602774 16:58066592-58066614 GCTCACTTTCTTGCCCAGGCTGG + Intergenic
1139767237 16:69241204-69241226 CCTCACTTTCTAGCCCAGGCTGG + Intronic
1139799118 16:69506889-69506911 GCTCATTCTCTCTCTCAGGCTGG - Intergenic
1140551529 16:75871058-75871080 TCTCACTTTGTATCCCAGGCTGG - Intergenic
1141068096 16:80930147-80930169 GCTCACTCTCTATCTTGCACAGG - Intergenic
1145093608 17:20006048-20006070 TCTCACTTTCTTGCCCAGACTGG + Intergenic
1145807091 17:27742253-27742275 TCTCACTTTCTTGCCCAGACTGG - Intergenic
1145832211 17:27925627-27925649 TCTCACTTTGTTGCTCAGACTGG + Intergenic
1146725905 17:35155512-35155534 GGTCAGTTGCTACCTCAGACTGG + Intronic
1147229414 17:39006305-39006327 GCTCACTATGTTTCCCAGACTGG + Intergenic
1148618219 17:49015463-49015485 GCTCACGATCCTTCTCAGACTGG - Intronic
1148919437 17:51017513-51017535 TCTCTCTCTCTCTCTCAGACAGG - Intronic
1149937181 17:60819767-60819789 CCTCACTCTCTTTCTGAGACAGG + Intronic
1150816643 17:68397089-68397111 ACTAACTTCCTTTCTCAGACGGG + Intronic
1152834642 17:82521200-82521222 GCTCACTTTGTCGCTCAGGCTGG + Intronic
1153109249 18:1564402-1564424 GCTCATTTTGTTTCTCAGCCTGG - Intergenic
1153489587 18:5633067-5633089 TCTCACTTTCTTGCTCAGGCTGG - Intergenic
1155445410 18:25906655-25906677 GCTCACTTTGTAGCCCAGGCTGG + Intergenic
1155779510 18:29812967-29812989 GCTCTCTTTCTTTCTCATATGGG - Intergenic
1157381482 18:47222284-47222306 TCTCACTTTGTCACTCAGACTGG - Intronic
1158600653 18:58853250-58853272 TCTCTCTTTCTTTCTGAGACGGG - Intergenic
1158772052 18:60530860-60530882 TCTCACTTTGTTGCTCAGACTGG + Intergenic
1159190676 18:65037408-65037430 GCACATTTTGTAACTCAGACAGG + Intergenic
1159697420 18:71577376-71577398 TCTCACTCTGTCTCTCAGACTGG - Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
1162928832 19:13945457-13945479 TCTCACTTTGTTTCTCAGGCTGG - Intronic
1164217294 19:23161148-23161170 GCTCTCTTCACATCTCAGACGGG + Intergenic
1164931161 19:32177359-32177381 CCTCACTTTGTTTCCCAGACTGG - Intergenic
1165106795 19:33474948-33474970 TCTCACTTTGTCTCTCAGGCTGG - Intronic
1165254923 19:34570727-34570749 TCTCTCTTTATTTCTCAGACCGG + Intergenic
1167068401 19:47204534-47204556 TCTCACTTTGTCTCTCAGACTGG + Intronic
925561472 2:5200465-5200487 CCCCACTTTCTATCCAAGACTGG - Intergenic
927431379 2:23029172-23029194 TCTCACTTTGTTTCTCAGGCTGG + Intergenic
927540841 2:23910057-23910079 TCTCACTTTGTTTCCCAGACTGG + Intronic
930570977 2:53086781-53086803 GCTCTGTTTTTATCTCAGATAGG - Intergenic
931358575 2:61558511-61558533 TCTCACTTTGTATCCCAGGCTGG + Intergenic
933104546 2:78307147-78307169 GCTAACTTTCACTCTCAGAATGG - Intergenic
933699009 2:85241221-85241243 GCTCTCTTTCTTTCTCAGTGTGG + Intronic
935586690 2:104806680-104806702 GCTCTTTTTCTAGCTCATACAGG + Intergenic
935792753 2:106608972-106608994 TCTCACTTTGTTTCTCAGGCTGG + Intergenic
937345325 2:121121831-121121853 GCTCACTTGCTCTGTCAGATGGG - Intergenic
938670826 2:133584732-133584754 GCTCACTCTGTTTCCCAGACTGG - Intergenic
939156103 2:138525806-138525828 GTTCTCATTCTAACTCAGACTGG - Intronic
939908079 2:147943353-147943375 TCTCACTTTGTTGCTCAGACTGG - Intronic
940662245 2:156561075-156561097 TCTCACTTTGTAGCTCAGGCTGG + Intronic
942178861 2:173360670-173360692 GCTCACTTTGTTGCTCAGGCTGG + Intronic
942762109 2:179411712-179411734 TCTCACTCTGTCTCTCAGACTGG + Intergenic
944633699 2:201654004-201654026 TCTCACTTTCTCGCCCAGACTGG + Intronic
944660444 2:201917126-201917148 TCTCACTTTGTTTCTCAGGCTGG - Intergenic
944856637 2:203774578-203774600 GGTCGCTTTCTTTCTCAAACAGG - Intergenic
945347966 2:208741255-208741277 TCTAACTTGCTATCGCAGACTGG + Intronic
945456480 2:210057371-210057393 TCTCACTTTCTCTCCCAGGCTGG - Intronic
946118732 2:217489896-217489918 ACTCACTTGCAATCTCATACGGG + Intronic
947434169 2:230058660-230058682 TCTCACTTTGTCTCTCAGGCTGG + Intronic
947764855 2:232631305-232631327 TCTCTCTCTCTCTCTCAGACAGG + Intronic
948450628 2:238068541-238068563 ACTCTCTTTCTTTCTGAGACAGG - Intronic
1169431305 20:5538741-5538763 TCTCTCTCTCTCTCTCAGACAGG - Intergenic
1169521385 20:6377260-6377282 GCTGACTTTCCAGCTAAGACAGG + Intergenic
1170475452 20:16709731-16709753 TCTCACTTTGTCTCTCAGGCTGG + Intergenic
1170818217 20:19733305-19733327 TCTCACTTTCTTGCTCAGGCTGG + Intergenic
1170974284 20:21147863-21147885 GCTCATTTTCTACCACTGACTGG - Intronic
1172407314 20:34699524-34699546 CCTCACTCTCTATCTCAGGTCGG + Intronic
1173610988 20:44367749-44367771 TCTCACTTTGTAGCTCAGGCTGG - Intronic
1173802147 20:45900722-45900744 TCTCACTTTGTAGCTCAGGCTGG + Intronic
1174642428 20:52056033-52056055 TCTCACTTTGTAGCCCAGACTGG - Intronic
1176963658 21:15188032-15188054 TCTCACTCTGTCTCTCAGACTGG - Intergenic
1177711208 21:24776946-24776968 TCTCACTCTGTAGCTCAGACTGG + Intergenic
1177796419 21:25783010-25783032 TCTCACTCTGTCTCTCAGACTGG - Intergenic
1178791362 21:35703265-35703287 GCTCACTCTCTATCTCAGTTGGG - Intronic
1179326774 21:40354395-40354417 GCTCACTCTGTAGCTCAGGCTGG + Intronic
1179419766 21:41226028-41226050 GCTCAGTGTGTATCTGAGACAGG + Intronic
1180621708 22:17166952-17166974 CCACACATTCCATCTCAGACTGG - Intergenic
1181789857 22:25256698-25256720 TCTCACTCTCTCTCTCAGGCTGG + Intergenic
1183111913 22:35656434-35656456 CCTCACTTTCTCTCTCCGCCTGG - Exonic
949709693 3:6860302-6860324 GCGCACTTTCTAGCACTGACAGG - Intronic
952110579 3:30119532-30119554 TCTCTCTCTCTCTCTCAGACTGG + Intergenic
952749442 3:36813546-36813568 GCTCACTCTCTACCACAGGCAGG - Intergenic
952814063 3:37431611-37431633 TCTCACTCTCTCGCTCAGACTGG + Intronic
954055406 3:48019310-48019332 TCTCACTTTCTCGCCCAGACTGG - Intronic
955624308 3:60900404-60900426 TCTCACTATGTAGCTCAGACTGG - Intronic
959709588 3:109371812-109371834 TCTCACTTTGTAGCTCAGGCTGG + Intergenic
959908298 3:111734380-111734402 GCTCACTTTGTTGCTCAGGCTGG - Intronic
961189688 3:124948243-124948265 TCTCACTTTGTTGCTCAGACTGG + Intronic
963785571 3:149531264-149531286 AATAACTTTCTAACTCAGACTGG - Intronic
964689197 3:159431032-159431054 GCTCACTGTGTACCTCAAACTGG - Intronic
964977982 3:162642191-162642213 CTTCACATTTTATCTCAGACAGG + Intergenic
967034899 3:185641382-185641404 TCTCACTTTCTTGCCCAGACTGG + Intergenic
968818397 4:2833332-2833354 TCTCACTGTCTTTCTCAGGCTGG + Intronic
972454710 4:39242284-39242306 TCTCACTTTCTTTCCCAGGCTGG + Intronic
973791949 4:54385890-54385912 GCTCTCTGTCTCTGTCAGACAGG + Intergenic
979585943 4:122417305-122417327 GCTCACTTTGTTGCTCAGGCTGG - Intronic
979657772 4:123216862-123216884 GCTCACTTTGTTGCCCAGACTGG + Intronic
980269404 4:130564428-130564450 TCTCACTCTCTTGCTCAGACTGG + Intergenic
980411183 4:132421717-132421739 GCTCTCTCTCTCTCTCAAACTGG - Intergenic
980954100 4:139410714-139410736 TCTCATTTTCTAACTCAGAGAGG - Intronic
981098945 4:140810151-140810173 TCTCTCTTTCTCTCTCAGACAGG + Intergenic
981866807 4:149431173-149431195 TCTCACTTTGTAGCCCAGACTGG - Intergenic
982018356 4:151178107-151178129 GCTCACTATCTTGCTCAGGCAGG + Intronic
982031976 4:151309982-151310004 GCTGACTTTCTTTTTGAGACAGG - Intronic
982681921 4:158441517-158441539 TCTCACTCTCTAACTCAGGCTGG - Intronic
982735204 4:158998962-158998984 GCTCACTATGTTTCTCAGGCTGG - Intronic
984064208 4:175028159-175028181 TGTCCCTTTATATCTCAGACCGG - Intergenic
984115606 4:175676714-175676736 TCTCACTTTGTTTCTCAGGCTGG - Intronic
984339561 4:178438699-178438721 TCTCACTTTGTAGCCCAGACTGG + Intergenic
988863997 5:35315203-35315225 GCTCACTCTGTTGCTCAGACTGG + Intergenic
990293029 5:54374300-54374322 GCTCACTTTGTCGCTCAGGCTGG + Intergenic
990934325 5:61131223-61131245 TCTCACTTTCTTTCCCAGGCTGG + Intronic
992382503 5:76252147-76252169 TCTCACTTTGTCTCCCAGACTGG + Intronic
992674723 5:79094698-79094720 TCTCACTTTGTTGCTCAGACTGG + Intronic
993205425 5:84872659-84872681 TCTCACTTTCTCACTCAGGCTGG + Intergenic
994724765 5:103421450-103421472 GCTCACTTTCTATGCTATACAGG + Intergenic
995251045 5:109993494-109993516 GCTCACTCTGTCACTCAGACTGG - Intergenic
996493522 5:124127189-124127211 TCTCACTTTCTTGCCCAGACTGG + Intergenic
997662094 5:135597199-135597221 TCTCTATCTCTATCTCAGACTGG + Intergenic
998656251 5:144182739-144182761 TCTCTCTCTCTCTCTCAGACAGG - Intronic
999214535 5:149920862-149920884 TCTCTCTTTCTCTCTCAGATAGG - Intronic
1000716787 5:164653776-164653798 GCTCTCTTTCTGTCTCAGCTTGG + Intergenic
1000721736 5:164716859-164716881 TCTCACTTTGTCTCACAGACTGG + Intergenic
1001531887 5:172469182-172469204 GCTCACTTTGTCTCCCAGGCTGG + Intergenic
1001710769 5:173776201-173776223 GTTCACTTTCAATATAAGACTGG - Intergenic
1001714325 5:173802609-173802631 TCTCACTCTCTCTCTCAGGCTGG - Intergenic
1002654727 5:180736463-180736485 TCTCACTTCCTCTCTCAGATGGG + Intergenic
1004296790 6:14419786-14419808 TCTCTCTTTCTTTGTCAGACTGG + Intergenic
1005692291 6:28319228-28319250 GCACATTTTTCATCTCAGACAGG + Intergenic
1005894932 6:30169974-30169996 TCTCAGTTTCTTCCTCAGACTGG - Intronic
1005985367 6:30870361-30870383 TCTCACTCTGTCTCTCAGACTGG + Intergenic
1006530170 6:34645402-34645424 GCTCACTCTGTAATTCAGACTGG + Intronic
1007335236 6:41150789-41150811 GCTATCTTCCTATCTCAGCCTGG - Intronic
1007639333 6:43324969-43324991 TCTCACTCTCTAACCCAGACTGG - Intronic
1007718706 6:43872559-43872581 GCTCAGATTCTATCCCAGCCTGG - Intergenic
1008190138 6:48446232-48446254 GCCTACTTTCTATCTCTGAGAGG + Intergenic
1010299211 6:74240119-74240141 TCTCTCTTTCTATCTTAGTCTGG + Intergenic
1010891017 6:81310610-81310632 CCTCACTCTGTATCTCAGACTGG - Intergenic
1010923710 6:81717306-81717328 TCTCACTTGCAATCTAAGACAGG + Intronic
1011124865 6:83996171-83996193 TCTCCCTTTATTTCTCAGACTGG + Intergenic
1011232902 6:85183476-85183498 ACTCACTTTGTCTCTCAGGCCGG + Intergenic
1012306162 6:97660665-97660687 TCTCTCTTTCTATCTTAGATAGG - Intergenic
1012440583 6:99258794-99258816 GCTCACTCTCTATGTCAAAATGG + Intergenic
1013660842 6:112295273-112295295 TCTCACTTTGTAGCTCAGGCCGG - Intergenic
1013700888 6:112767974-112767996 GCTCACTTGCTATCCCTGTCTGG - Intergenic
1013743314 6:113315083-113315105 GTACAATTTCTATCTCAGAGAGG + Intergenic
1016008926 6:139118431-139118453 TCTCACTTTATCTCCCAGACTGG - Intergenic
1016958525 6:149649588-149649610 CCTCACTTTGTCTCCCAGACTGG - Intergenic
1018242852 6:161795260-161795282 TCTCACTCTCTAGCTCAGGCTGG + Intronic
1020239805 7:6384830-6384852 TCTCACTTTGTCCCTCAGACTGG + Intronic
1020574553 7:9909645-9909667 TCTCTCTTTCTTTCTCAGTCAGG + Intergenic
1020772489 7:12412183-12412205 TCTCACTTTGTCTCTCAGGCTGG - Intergenic
1021406023 7:20268043-20268065 TCTCACTTTGTAACTCAGGCTGG + Intergenic
1021949084 7:25756407-25756429 CCTTACTTTCTATCTCATTCTGG - Intergenic
1022556689 7:31305317-31305339 TCTCACTTTCTCACTCAGGCTGG - Intergenic
1023842421 7:44104788-44104810 GCTCAGGTTCTAGCTCTGACAGG - Exonic
1026189143 7:68108863-68108885 GCTCTCTTTTTATCACTGACAGG - Intergenic
1026214023 7:68332360-68332382 TCTCACTATCTTGCTCAGACTGG + Intergenic
1026945393 7:74312848-74312870 GATCACTTCCTCCCTCAGACTGG - Intronic
1027126420 7:75559726-75559748 GCTCACTTTCTATCTCAGACAGG + Exonic
1027338502 7:77180501-77180523 TCTCACTTTGTTTCCCAGACTGG - Intronic
1027518550 7:79173525-79173547 TCTCACTTTGTTTCCCAGACTGG + Intronic
1027548326 7:79558647-79558669 GCTCACTCTGTGTCCCAGACTGG + Intergenic
1029475554 7:100781674-100781696 TCTCACTTTGTAGCTCAGGCTGG + Intronic
1029751387 7:102544528-102544550 CCTCACTTTCTAGCACACACAGG + Intronic
1029769339 7:102643622-102643644 CCTCACTTTCTAGCACACACAGG + Intronic
1029992213 7:104972985-104973007 GCTCACTTTGTTGCTCAGGCTGG - Intergenic
1031274192 7:119697303-119697325 TCTCACTTTTTTTCTCAGCCTGG - Intergenic
1031568271 7:123326485-123326507 GCTCAATTTCAAATTCAGACTGG - Intergenic
1032030758 7:128481838-128481860 TCTCACTTTGTTTCCCAGACTGG + Intronic
1032527280 7:132588352-132588374 GCACACATTCTTTCACAGACAGG - Intronic
1033646227 7:143306689-143306711 TCTCACTATGTTTCTCAGACTGG + Exonic
1036645402 8:10609094-10609116 GCTCACTTTCTTCCTCACGCAGG + Exonic
1037563500 8:20096026-20096048 TCTCACTTTGTAGCTCAGGCTGG - Intergenic
1039487476 8:37922352-37922374 TCTCACTTTCTCTCCCAGGCTGG + Intergenic
1039555248 8:38470469-38470491 GCTCACTTTGTTTCCCAGGCTGG - Intergenic
1039598492 8:38812428-38812450 ACTCTTTTTATATCTCAGACTGG + Intronic
1040692010 8:49950095-49950117 TCTCACTCTGTATCTCAGACTGG - Intronic
1041907788 8:63052632-63052654 TTTCACTTTATTTCTCAGACCGG + Intronic
1042250270 8:66749359-66749381 TCTCACTCTGTAGCTCAGACTGG - Intronic
1042701356 8:71618453-71618475 TCTCACTTTGTCGCTCAGACTGG + Intergenic
1042991804 8:74648646-74648668 TTTCTCTTTATATCTCAGACTGG + Intronic
1043459561 8:80445859-80445881 TCTCACTCTCTCGCTCAGACTGG - Intergenic
1044967730 8:97589369-97589391 TCTCACTTTCTCACTCAGACTGG + Intergenic
1049014575 8:139910597-139910619 GCTCACTATCTATGGCACACTGG - Intronic
1050853784 9:10323499-10323521 TCTCACTGTGTTTCTCAGACTGG + Intronic
1051050969 9:12930918-12930940 GGACACTCTCTCTCTCAGACTGG + Intergenic
1051152287 9:14095873-14095895 GCTCACTTTGTTTCACACACAGG - Intronic
1052600699 9:30626454-30626476 TCTCACTTTGTCTCCCAGACTGG + Intergenic
1052680241 9:31682059-31682081 TCTCACTTCCTATCTCATAACGG + Intergenic
1052912362 9:33894865-33894887 TCTCACTTTGTCTCTCAGGCTGG - Intronic
1052957536 9:34265196-34265218 TCTCACTTTGTATCTCAGGCTGG + Intronic
1053080624 9:35173451-35173473 TCTCACTTTGTAGCTCAGGCTGG + Intronic
1057575334 9:96237932-96237954 GCTCACTTTGTTGCCCAGACTGG - Intronic
1058225506 9:102356560-102356582 GTACACTTTATTTCTCAGACTGG + Intergenic
1058317603 9:103587692-103587714 TTTCACTTTCCTTCTCAGACTGG + Intergenic
1058431405 9:104923842-104923864 TCTCACTATCTTGCTCAGACTGG - Intronic
1058772822 9:108254324-108254346 TCTCACTTTATCACTCAGACTGG + Intergenic
1059615587 9:115947406-115947428 TCTCACTTTTTCTCCCAGACTGG - Intergenic
1203654741 Un_KI270752v1:12521-12543 ACTCACTTTGTATCCCAGGCTGG + Intergenic
1185535184 X:855415-855437 TCTCACTTTGTAGCTCAGGCTGG + Intergenic
1186058462 X:5677208-5677230 GCTCATTTTCAATCTTGGACTGG - Intergenic
1186707208 X:12154306-12154328 GCTCACTTTCTTTCCCACAAAGG + Intronic
1188583471 X:31744061-31744083 TCTCACTTTGTTTCCCAGACTGG + Intronic
1189693888 X:43643984-43644006 GCTCACTATGTTTCTCAGGCTGG - Intergenic
1192750459 X:73984941-73984963 TCTCACTCTCTTGCTCAGACTGG + Intergenic
1192874603 X:75215474-75215496 TCTCACTTTCTTTCTTAGCCTGG - Intergenic
1196562849 X:117171777-117171799 TCTCACTTTGTGACTCAGACTGG - Intergenic
1197230563 X:123999447-123999469 TCTCCCTGTCTCTCTCAGACAGG + Intronic
1201127544 Y:10928433-10928455 TCTCACTCTGTAACTCAGACTGG + Intergenic