ID: 1027133636

View in Genome Browser
Species Human (GRCh38)
Location 7:75609264-75609286
Sequence AGAGCCCACTCTATGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027133628_1027133636 16 Left 1027133628 7:75609225-75609247 CCAAGCAACACTTCATCATAGTG 0: 1
1: 0
2: 0
3: 15
4: 115
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1027133627_1027133636 17 Left 1027133627 7:75609224-75609246 CCCAAGCAACACTTCATCATAGT 0: 1
1: 0
2: 0
3: 17
4: 129
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1027133623_1027133636 26 Left 1027133623 7:75609215-75609237 CCCCAGTTCCCCAAGCAACACTT 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1027133624_1027133636 25 Left 1027133624 7:75609216-75609238 CCCAGTTCCCCAAGCAACACTTC 0: 1
1: 0
2: 1
3: 17
4: 179
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1027133625_1027133636 24 Left 1027133625 7:75609217-75609239 CCAGTTCCCCAAGCAACACTTCA 0: 1
1: 0
2: 12
3: 21
4: 176
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1027133626_1027133636 18 Left 1027133626 7:75609223-75609245 CCCCAAGCAACACTTCATCATAG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027133636 Original CRISPR AGAGCCCACTCTATGGTTTG GGG Intronic
900611039 1:3544764-3544786 AAACCCCACTCGATGGTGTGTGG - Intronic
904495238 1:30882725-30882747 AGAGCCCACTCCAGAATTTGGGG + Intronic
905482353 1:38270406-38270428 GGAGCCAACTCTGTGGGTTGGGG - Intergenic
909200757 1:72687683-72687705 AGAGCTCAGGCTATGGTTTAAGG - Intergenic
911698936 1:100927570-100927592 AGGGCCCACTTTGAGGTTTGTGG + Intronic
913616701 1:120567041-120567063 AGGGCCCACTTTCTGGTTTATGG - Intergenic
914573574 1:148943869-148943891 AGGGCCCACTTTCTGGTTTATGG + Intronic
915837157 1:159186856-159186878 AGAGCACTCACTCTGGTTTGTGG - Intronic
919833942 1:201560894-201560916 TGAGCCCACTGTCTGCTTTGTGG - Intergenic
924103727 1:240630291-240630313 AGAGCCCACTCTATACTTAATGG - Intergenic
1067288125 10:44922181-44922203 ACAGCCCACTCCTTGTTTTGTGG - Intronic
1069947722 10:71999313-71999335 AGAGCCCACTCCAAGGTGTTTGG + Intronic
1070251408 10:74776588-74776610 AGAGTCCCTTCTATGATTTGGGG + Intergenic
1073739854 10:106394071-106394093 AGGTCACATTCTATGGTTTGAGG + Intergenic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1078742464 11:14080030-14080052 AGTGGCTACTCTGTGGTTTGGGG + Intronic
1079487595 11:20951728-20951750 AGAGGCCACTTTGTAGTTTGTGG + Intronic
1084802539 11:71554632-71554654 AAAACCCACTCTGTGGTCTGAGG + Intronic
1087083925 11:94197759-94197781 AGAGCTCACTTCCTGGTTTGTGG + Intergenic
1088604121 11:111512522-111512544 AGAGCCAGCTCTAGGGTTTGGGG + Intergenic
1091131977 11:133153964-133153986 AGTGCCCACTTTTTGGTTGGAGG + Intronic
1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG + Intergenic
1093369400 12:18349036-18349058 AAAGCCAACTCTATGGCCTGAGG - Intronic
1093828242 12:23721750-23721772 ACAGCCAACTCCATGCTTTGTGG - Intronic
1097386824 12:58960009-58960031 AGACCCAAGTCCATGGTTTGTGG + Intergenic
1098826149 12:75300248-75300270 AGAGCAAATTCTATGGTGTGAGG - Intronic
1107389880 13:39952949-39952971 AGAGCCCAGTGTATGTTCTGTGG + Intergenic
1114339033 14:21723796-21723818 AGAGCCCACTCTCTGGGGTGGGG + Intergenic
1114932263 14:27487627-27487649 AGAGCCCTCTCCTTGGCTTGCGG + Intergenic
1115665918 14:35546291-35546313 AAAGCCCACTTTCTGGTTAGCGG - Intronic
1116411572 14:44630606-44630628 AGAGCCCAATCTAAGGTTTTCGG - Intergenic
1116777958 14:49203257-49203279 ACACCCCACTCTATGCTTTGTGG - Intergenic
1119857426 14:77910948-77910970 AGAGGCCAATCTAGGGTGTGAGG - Intronic
1121580076 14:95023510-95023532 AGTGCCCACTTTACGGTTTCTGG - Intergenic
1123895371 15:24823683-24823705 AGAGCCTTCTGTGTGGTTTGCGG + Exonic
1125006702 15:34824791-34824813 TCAGCCCATTCCATGGTTTGAGG + Intergenic
1128734184 15:70043218-70043240 AGAGCCCACTGTGTGGTGGGAGG + Intergenic
1129753722 15:78083448-78083470 AAAGCCCTCTCTCTGGTCTGGGG - Intronic
1134012742 16:10867305-10867327 AGAGCCCACTGTGTGTGTTGGGG + Intergenic
1138046768 16:53733007-53733029 GGGGCTCCCTCTATGGTTTGAGG - Intronic
1138766933 16:59616319-59616341 ACAGACCATTCAATGGTTTGGGG + Intergenic
1141352809 16:83314456-83314478 AGAGCACCCTCTGTGATTTGAGG + Intronic
1143996405 17:11010226-11010248 AGAGCCCAGTCCATGGTCGGTGG - Intergenic
1149420884 17:56510261-56510283 AGAGCCCACTACATAATTTGTGG + Intronic
1151554739 17:74841003-74841025 AGACCCCACTGTTTGGGTTGGGG - Intergenic
1152381131 17:79942733-79942755 AGAGATGACTCTAGGGTTTGTGG + Intronic
1157321178 18:46635878-46635900 AGAGCCCCCTAGATGGATTGAGG + Intronic
1165228119 19:34368415-34368437 AGAACCCACTGTATGCTTAGAGG - Intronic
1165365051 19:35360116-35360138 AGAGCCCAATCCATAGTGTGTGG - Exonic
1165366870 19:35372585-35372607 AGAGCCCAATCCATAGTGTGTGG - Intronic
928671750 2:33610049-33610071 ATCGCTCACTCTATTGTTTGTGG - Intergenic
931786591 2:65624235-65624257 AGAGCCATTTCTATTGTTTGTGG + Intergenic
932091709 2:68811574-68811596 AGAGCCCACTCTATGCTCCATGG - Intronic
932739945 2:74283619-74283641 AGAGCCCAGGCCATGGTTGGGGG + Intronic
935365192 2:102281854-102281876 AGAGGCCACTGTATGCTTTCAGG + Intergenic
936369421 2:111891210-111891232 ATAGCTCACGCTATTGTTTGTGG - Intergenic
936800068 2:116255824-116255846 ATAGCTCACTCTATTGTTTGTGG - Intergenic
937692094 2:124768034-124768056 CTAGCCCACTCTCTGGTGTGGGG - Intronic
939863330 2:147444727-147444749 AGAGCCAATTCTATTGATTGAGG - Intergenic
948633038 2:239314060-239314082 AGACCCCTCGCAATGGTTTGGGG + Intronic
1170296914 20:14837230-14837252 ATAGCCCATTCTATGGTCTTTGG - Intronic
1170307502 20:14955775-14955797 AGAGTCCAGTCTATAGTTTTGGG - Intronic
1173964058 20:47098559-47098581 GGAGCCCACAGTTTGGTTTGAGG - Intronic
1174671835 20:52315355-52315377 AAAGCTTACTCTATGGTTTTTGG + Intergenic
1177731804 21:25036846-25036868 AGAGCACCTTCTATAGTTTGGGG - Intergenic
949596691 3:5555139-5555161 AGGGCCCACTTACTGGTTTGTGG - Intergenic
949940198 3:9148832-9148854 TCAGCCCACTCTCAGGTTTGGGG - Intronic
951630758 3:24717268-24717290 AGAGCACACCAAATGGTTTGGGG + Intergenic
960829152 3:121826870-121826892 AGAGACCATTCTTGGGTTTGAGG - Intronic
963224988 3:142853332-142853354 AGAGCCCACCTTCGGGTTTGGGG - Intronic
963538421 3:146557069-146557091 ATAGCTCACACTATTGTTTGTGG - Intergenic
964191219 3:154003226-154003248 AAAGCCCACCCTATGATTTGTGG + Intergenic
966976855 3:185092449-185092471 AAAGCAAACTCTAGGGTTTGGGG - Intronic
970790171 4:19848908-19848930 TGAGCCCTTTCTATGTTTTGGGG + Intergenic
973578386 4:52315583-52315605 TGAGGCCACTCTCTGTTTTGTGG - Intergenic
973889435 4:55354436-55354458 AGAAGCTACTCTATGGTTTGGGG - Intronic
976191089 4:82487765-82487787 AGAGCCCATTCTCTAGTTAGTGG - Intronic
977921342 4:102646687-102646709 AGATCTCACTCTCTAGTTTGAGG - Intronic
978065538 4:104395248-104395270 AAAGCCTGCTCTATGGCTTGGGG + Intergenic
980903517 4:138927604-138927626 AGGACCCACTTTCTGGTTTGCGG - Intergenic
982840427 4:160177368-160177390 AGAGTACATTCTATTGTTTGGGG - Intergenic
989168046 5:38449557-38449579 AGAGACCACTAGGTGGTTTGGGG + Intronic
994153711 5:96478791-96478813 AGTGCCCATTTTATGGTTTCTGG - Intergenic
995553916 5:113308437-113308459 AGTGGGCACTCTCTGGTTTGGGG - Intronic
998260043 5:140623671-140623693 AGGGATGACTCTATGGTTTGAGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001086090 5:168700965-168700987 AGAGCCCAGGCTATGGATTCAGG + Intronic
1001175267 5:169462743-169462765 AGAGCCCTCTTCTTGGTTTGTGG - Intergenic
1001177610 5:169486599-169486621 AGAGCCCTCTCTTTTGCTTGAGG + Intergenic
1002977810 6:2101944-2101966 AGAGCGCACACTGTTGTTTGAGG - Intronic
1003849415 6:10206582-10206604 AGAGCCCTCTTTAGGGCTTGAGG - Intronic
1010388166 6:75306109-75306131 AGAGCCCACTCTATATTTATTGG - Intronic
1013480713 6:110550511-110550533 TGGGCCCACTCTCAGGTTTGGGG - Intergenic
1017151090 6:151281465-151281487 AGTGCCCACTTTATCTTTTGAGG + Intronic
1018554387 6:165034956-165034978 AGTGCCCATTCTTTGGTCTGGGG + Intergenic
1022637910 7:32154726-32154748 GGTGCCCACTGTATGGTATGGGG - Intronic
1022898089 7:34773169-34773191 AGAGCCCACTTCATGGTGTTGGG - Intronic
1023055024 7:36284176-36284198 AGAGCCCACTCAGTGTTTTCTGG - Intronic
1026760089 7:73120154-73120176 AGGGCCCACTTCCTGGTTTGTGG - Intergenic
1027036431 7:74928966-74928988 AGGGCCCACTTCCTGGTTTGTGG - Intergenic
1027087132 7:75272500-75272522 AGGGCCCACTTCCTGGTTTGTGG + Intergenic
1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG + Intronic
1029393438 7:100290481-100290503 AGGGCCCACTTCCTGGTTTGTGG + Intergenic
1034542809 7:151769825-151769847 GGTGCCCACTCTATGGGGTGGGG - Intronic
1038648982 8:29385339-29385361 TCATCCCACTCTTTGGTTTGAGG + Intergenic
1039211425 8:35219680-35219702 ACAACACACTCCATGGTTTGGGG + Intergenic
1039851015 8:41364934-41364956 AGGGCCCACTCTCAGGTATGAGG + Intergenic
1040475564 8:47774265-47774287 AAAGCCCACTCTCTGGTTCTTGG + Exonic
1042741112 8:72048141-72048163 AGAGCCACCTCTATGGTGTGTGG + Intronic
1042756764 8:72222948-72222970 AGAGCCACCCCTATGGTGTGTGG + Intergenic
1047919700 8:129621745-129621767 AGAGACCATTCTTGGGTTTGAGG - Intergenic
1050283213 9:4074231-4074253 TGAACCCAAACTATGGTTTGGGG - Intronic
1054990773 9:71323660-71323682 AAAGGTCACGCTATGGTTTGAGG + Intronic
1056602427 9:88056564-88056586 AGAGCCCTTTCCAGGGTTTGTGG + Intergenic
1059843666 9:118246815-118246837 AGAGACCACTACATGATTTGAGG + Intergenic
1061378753 9:130241726-130241748 AGTGCCCACTTTATTCTTTGAGG + Intergenic
1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG + Intronic
1197478731 X:126955958-126955980 GGAGCCCAATGTATTGTTTGTGG - Intergenic