ID: 1027134577

View in Genome Browser
Species Human (GRCh38)
Location 7:75615139-75615161
Sequence TTTGCCATACAACCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027134573_1027134577 21 Left 1027134573 7:75615095-75615117 CCTACTACACGCAGGGCAAGGCT 0: 1
1: 0
2: 0
3: 12
4: 90
Right 1027134577 7:75615139-75615161 TTTGCCATACAACCACAAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 158
1027134575_1027134577 -3 Left 1027134575 7:75615119-75615141 CCACACAGATAGTAAGGCTCTTT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1027134577 7:75615139-75615161 TTTGCCATACAACCACAAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027134577 Original CRISPR TTTGCCATACAACCACAAGA GGG Intronic
900280305 1:1862939-1862961 ACTGCCATACACACACAAGAGGG + Intronic
900857096 1:5195033-5195055 CTTCCCATACCACCACAAGCTGG + Intergenic
903496614 1:23772294-23772316 TTTCCCATCCAACCAGACGAGGG + Intergenic
905547018 1:38807952-38807974 TTAGCCACACAATCCCAAGAGGG - Intergenic
907361709 1:53921757-53921779 TTTCCCATACAGGCACATGATGG - Exonic
912114208 1:106384208-106384230 ATTGCCAGACAACCAGCAGAAGG - Intergenic
915057281 1:153145344-153145366 TTTGGTAGATAACCACAAGAAGG + Intergenic
919684806 1:200473790-200473812 TTTGGCATAAAATCACAAGTGGG - Intergenic
920456646 1:206106764-206106786 TTTGCCATAGGACCACAAGGTGG - Intergenic
920562027 1:206945704-206945726 TTTGCCAGAAAGCCACAAGTGGG + Intronic
921199791 1:212793527-212793549 TTTGCCATACAGCAGCAAAATGG - Intronic
921809855 1:219500378-219500400 TTTGCCAAACAATCATATGATGG - Intergenic
923354013 1:233136048-233136070 TTTGCCCTCCAATCTCAAGATGG - Intronic
924818443 1:247463663-247463685 TTAGGTATACACCCACAAGAGGG + Intergenic
1067772380 10:49136118-49136140 CTTGCCTTACAAAAACAAGAGGG + Intergenic
1071277100 10:84065392-84065414 CTTGCCTTAAAACCAGAAGACGG + Intergenic
1071783812 10:88877473-88877495 GTTGCCATAAAACAACAGGATGG + Intergenic
1073275866 10:102310866-102310888 TTTGCCATTCAACACCAAAATGG - Intronic
1074468423 10:113705232-113705254 TTTGCCTCACAGCCACTAGATGG + Intronic
1076292542 10:129358198-129358220 TTTACCATACAAACTGAAGAGGG - Intergenic
1076631595 10:131855286-131855308 TGTGCCACACACACACAAGACGG + Intergenic
1076766567 10:132637994-132638016 TTTGCAATACCAACACAAGAGGG - Intronic
1079407820 11:20160947-20160969 ATTGCCCTACCCCCACAAGAGGG - Intergenic
1080120618 11:28673258-28673280 TTTGCAAAACAACCACAAAAGGG - Intergenic
1080338915 11:31233626-31233648 TTTGCCTTCCAACCACCAGGTGG - Intronic
1080443029 11:32313034-32313056 TTTCCCAAAGAACCACTAGAGGG + Intergenic
1080925369 11:36750613-36750635 ATTGCCACAAAACCACATGAGGG + Intergenic
1081201351 11:40219891-40219913 TTTGCCATAAAAACAAAAAATGG + Intronic
1082775828 11:57243785-57243807 CTTGCCATTCATCAACAAGAGGG - Intergenic
1082965273 11:58960543-58960565 CTTGCCATGCCACCACGAGAAGG + Intronic
1082974115 11:59055364-59055386 TTTGCCATGCCATCACGAGAAGG + Intergenic
1082978528 11:59099155-59099177 TTTGCCATGCCACCACGAGAAGG + Intergenic
1086791307 11:91041803-91041825 TTGATCATTCAACCACAAGATGG + Intergenic
1087814535 11:102644141-102644163 AATGTCATAGAACCACAAGACGG + Intergenic
1090825653 11:130383707-130383729 TTTGACCTCCAACCACAAAAAGG - Intergenic
1092306527 12:7306558-7306580 TTTGCCATTCACCCACCACAGGG - Exonic
1093680091 12:21992702-21992724 CTTGCCATATAACCAAGAGAAGG + Intergenic
1096682724 12:53267654-53267676 TTTCTCATACAACCAATAGAAGG + Intergenic
1097807614 12:63983262-63983284 TTTGCCATTCAAACTCAAAAGGG + Intronic
1098740932 12:74172114-74172136 TTTGCCATAGCACCAGAAAATGG - Intergenic
1101568344 12:105930726-105930748 TTTGCACAACAACCACATGAGGG - Intergenic
1107922502 13:45224098-45224120 TTTGCCATATAATCAAAAAATGG - Intronic
1109400290 13:61818656-61818678 TTTGCAATACCAGAACAAGATGG - Intergenic
1112168140 13:96941981-96942003 TTTGTAATACAAGAACAAGAAGG - Intergenic
1112788381 13:102976842-102976864 TTTTCTAGACAACCACAGGATGG + Intergenic
1113737285 13:112688090-112688112 TTTGCCAGACAACCCCCAGCAGG + Intergenic
1115530614 14:34323587-34323609 TTTGCCATTCTACTAGAAGACGG - Intronic
1115923984 14:38410649-38410671 TTGGGCATATACCCACAAGAGGG + Intergenic
1116484157 14:45426856-45426878 TTTTCAATACAACCACTAGGTGG + Intergenic
1117278629 14:54215468-54215490 TTTGCTTTACAGCCACAAAATGG + Intergenic
1120313105 14:82856361-82856383 TTTTCCATACAACTAGATGAGGG - Intergenic
1121977639 14:98420368-98420390 TTTGCCATCCAAACAAATGACGG - Intergenic
1123925652 15:25107840-25107862 TTTGTCAAACATGCACAAGAAGG - Intergenic
1125647077 15:41281781-41281803 TTTGCTATACAGCCAAAAGGGGG - Exonic
1126191126 15:45880019-45880041 ATTGCCATTCATCCACAACAAGG + Intergenic
1126344304 15:47676517-47676539 TTTTCCATATAAGCAAAAGATGG + Intronic
1127466737 15:59251010-59251032 TTTGGCACACACCCAGAAGAGGG + Intronic
1128221056 15:65969025-65969047 TTTGCCAATCAACCACAGGAGGG - Intronic
1131313874 15:91315528-91315550 ACTATCATACAACCACAAGAAGG - Intergenic
1131946726 15:97630121-97630143 TTTTCCGTACAACCACAGCATGG + Intergenic
1134004934 16:10812396-10812418 TTGGCCATATACCCACAAGTGGG - Intronic
1137608562 16:49803620-49803642 TTTGACCTTCAACCACTAGATGG + Intronic
1139121333 16:64022250-64022272 TTTGCAATACAGACAGAAGAGGG - Intergenic
1140162229 16:72509144-72509166 TCTTACATACAAGCACAAGAAGG + Intergenic
1143918804 17:10314582-10314604 TTTACCATACAACAGAAAGATGG + Intronic
1144427363 17:15156249-15156271 TATGCCATTTTACCACAAGAGGG - Intergenic
1145194651 17:20880691-20880713 TTTGGCATACCATCACAAAAAGG - Intronic
1145376483 17:22353929-22353951 TTAGCTATACAACCACAGGAGGG - Intergenic
1153490782 18:5645915-5645937 TTTGACATACAATCAAAATAAGG + Intergenic
1157245273 18:46048304-46048326 TCTGCCCTACAACCTCCAGAAGG + Intronic
1158401621 18:57126659-57126681 TTCACCATACAGCCACAACATGG + Intergenic
1158674401 18:59505249-59505271 TTTGCCAAAGGACCACATGATGG + Intronic
1162121735 19:8474178-8474200 TTTTCCATACCACCACCAAAGGG - Exonic
1164845393 19:31428087-31428109 CTTCCCAGACAGCCACAAGACGG - Intergenic
1165210657 19:34233075-34233097 GTTTCCTTACAACCACAACATGG - Intergenic
1165346205 19:35250000-35250022 TTTGCCATTCACCCACAACAAGG - Intronic
1168437603 19:56333703-56333725 TTTGGCATACTACCAGCAGATGG - Intronic
1168523027 19:57067746-57067768 TTTGCCTAACAACCACATGAAGG - Intergenic
925924845 2:8662622-8662644 TTTGCCACACAACCAACATATGG - Intergenic
926188000 2:10706791-10706813 TTTTCCATACAACATCATGAAGG - Intergenic
928933361 2:36648475-36648497 TTTGCCTTACACCCCCAGGAGGG + Intergenic
932475447 2:72003110-72003132 TCTGCCCCACAACCACAAGGAGG + Intergenic
934912562 2:98272776-98272798 TATGCCATAATACCACAAGCTGG + Intronic
938879841 2:135573814-135573836 TTTGCTATACTAACAGAAGAGGG + Intronic
939690666 2:145256078-145256100 ATTGCTATACAACTACAAAATGG + Intergenic
940518004 2:154705253-154705275 TTGGCCATATATCCACGAGAAGG + Intronic
940788797 2:158010465-158010487 ATTTACAAACAACCACAAGATGG - Intronic
940839291 2:158560363-158560385 TTTTACATAAAATCACAAGAAGG - Intronic
942552233 2:177131443-177131465 TTTGCCACACAGCAACCAGAAGG - Intergenic
944724738 2:202459198-202459220 TTTGCCAAACAACTAAAAGTAGG - Intronic
945613229 2:212032266-212032288 TTTGCACTATAACCACAACATGG - Intronic
946666638 2:222057414-222057436 TATTCTATACAACCACTAGATGG + Intergenic
947702678 2:232247695-232247717 TTTATCATTCAACCACGAGATGG + Intronic
1174785948 20:53432981-53433003 ATTGCCTTACAACTGCAAGATGG + Intronic
1177366903 21:20151419-20151441 TTTGCGATATAACCTCAAGTGGG + Intergenic
1180218960 21:46345915-46345937 GCTGCCATTCAGCCACAAGAAGG - Intronic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954288360 3:49635657-49635679 TTTGACATTCAACAAAAAGATGG - Intronic
954837906 3:53486809-53486831 TTTGCAATACATAAACAAGATGG + Intergenic
956506723 3:69948467-69948489 TTTTCCACAAAGCCACAAGAGGG - Intronic
956566443 3:70643930-70643952 ATTGCAATTCAACCAAAAGATGG + Intergenic
957312255 3:78535780-78535802 TTAGACATACACCCAAAAGAGGG - Intergenic
958536375 3:95409555-95409577 ATTGAAATACAACCACAACAAGG + Intergenic
963132461 3:141871445-141871467 TTTGAAAAACAACCAAAAGAAGG - Intergenic
964554914 3:157926485-157926507 TTTGCCACACACTCACAAAAGGG - Intergenic
964678460 3:159310465-159310487 GTTGCCATTCAACCAGAGGAAGG + Intronic
976885098 4:89972466-89972488 TTTGCAATAAAATAACAAGAAGG - Intergenic
979826083 4:125234165-125234187 GATGCCATGCAACCTCAAGAAGG + Intergenic
982409790 4:155061715-155061737 TTTGCTATACAAACACCAAACGG - Intergenic
983500558 4:168494669-168494691 TTTGCAATACACACACAAAAAGG + Intronic
984276196 4:177612933-177612955 TTCGTCATACAAGCATAAGAAGG + Intergenic
985126821 4:186702721-186702743 TATTCCACACACCCACAAGAGGG + Intronic
986984485 5:13484805-13484827 TTGGCCATACAATGAGAAGATGG - Intergenic
987372201 5:17203525-17203547 TTTTCCAAATAACCACAAGGTGG - Intronic
987709222 5:21487364-21487386 TTTGCCATTCACCCATAAAATGG - Intergenic
988750390 5:34186788-34186810 TTTGCCATTCACCCATAAAATGG + Intergenic
991738651 5:69649987-69650009 TTTGCCATTCACCCATAAAATGG + Intergenic
991759547 5:69906440-69906462 TTTGCCATTCACCCATAAAATGG - Intergenic
991787789 5:70211678-70211700 TTTGCCATTCACCCATAAAATGG + Intergenic
991790226 5:70229728-70229750 TTTGCCATTCACCCATAAAATGG + Intergenic
991814975 5:70504819-70504841 TTTGCCATTCACCCATAAAATGG + Intergenic
991818110 5:70526104-70526126 TTTGCCATTCACCCATAAAATGG + Intergenic
991838776 5:70781506-70781528 TTTGCCATTCACCCATAAAATGG - Intergenic
991880235 5:71212042-71212064 TTTGCCATTCACCCATAAAATGG + Intergenic
991882675 5:71230068-71230090 TTTGCCATTCACCCATAAAATGG + Intergenic
992058540 5:73018607-73018629 TTTGCTATACAGCCAAAAGAGGG + Intronic
994016199 5:94968671-94968693 TATTGCATAAAACCACAAGATGG + Intronic
994421343 5:99528707-99528729 TTTGCCATTCACCCATAAAATGG - Intergenic
994485698 5:100385607-100385629 TTTGCCATTCACCCATAAAATGG + Intergenic
995632002 5:114144363-114144385 TTTGCCATTTATCCACAAAATGG + Intergenic
1005548458 6:26893091-26893113 TTTGCCATTCACCCATAAAATGG + Intergenic
1007133215 6:39496247-39496269 TTTGCCACATGACCACAGGACGG + Intronic
1008007553 6:46427708-46427730 ATTGACATACAACCATCAGAGGG + Intronic
1008445774 6:51588509-51588531 TTTACCAAACACCCACAAAAAGG - Intergenic
1009019219 6:57934201-57934223 TTTGCCATTCACCCATAAAATGG + Intergenic
1009387925 6:63109700-63109722 TTTTCCAGACAAACAAAAGATGG - Intergenic
1009615064 6:65993081-65993103 TTTGCCAGCAAACCACCAGAAGG - Intergenic
1011629683 6:89311653-89311675 ATTGCCAAAAAACCACAACACGG - Intronic
1011868063 6:91856418-91856440 TTTGCCATATAACTAAAAGCAGG - Intergenic
1014403799 6:121023689-121023711 TTTCCAATACAATCACATGAAGG - Intergenic
1015208970 6:130674150-130674172 TTTGACAAATAACCACAAGTGGG - Intergenic
1020382670 7:7564120-7564142 TTTGCCAGACAGCAAGAAGAGGG + Intergenic
1024144081 7:46493392-46493414 TCTGCCATTCACCCACTAGATGG + Intergenic
1026077166 7:67182593-67182615 TGTGCCATATAACCACAAGAGGG - Intronic
1026699706 7:72629508-72629530 TGTGCCACATAACCACAAGAGGG + Intronic
1027134577 7:75615139-75615161 TTTGCCATACAACCACAAGAGGG + Intronic
1027385064 7:77651727-77651749 TTTGCCATTCCACCAGAAGAGGG + Intergenic
1029969342 7:104773787-104773809 TTTGCCAGCAAACCACCAGAAGG + Intronic
1031764936 7:125766144-125766166 TTTGTTATAGAACCCCAAGAAGG - Intergenic
1032314878 7:130828260-130828282 TTTGCCAGACAAACAAAAGCTGG - Intergenic
1033764562 7:144474080-144474102 TTTCTATTACAACCACAAGAAGG - Intronic
1035288835 7:157824315-157824337 GCTGCCAGAGAACCACAAGAGGG + Intronic
1036979489 8:13454006-13454028 TTTGCCATTTAACCATGAGAAGG - Intronic
1037642897 8:20764233-20764255 TTTGCTAGATACCCACAAGAAGG - Intergenic
1042231264 8:66557209-66557231 TTTGCCATAGAACCAAAAGTTGG - Intergenic
1043699248 8:83263948-83263970 TTTGTGATACAACCATAAAATGG + Intergenic
1049279978 8:141739312-141739334 TTTTCCAAACAACCCCATGAGGG + Intergenic
1051078021 9:13263375-13263397 TTTGCCAAACAAGGACAAGGAGG - Intronic
1051382020 9:16468712-16468734 TTTCCCCAACAACCACCAGAAGG + Intronic
1051979005 9:22990458-22990480 TCTGTCCTACAACCACAAGGAGG - Intergenic
1056861304 9:90185587-90185609 TTTACTATAAAACAACAAGAAGG - Intergenic
1057664272 9:97032042-97032064 TTTGACACATAACCTCAAGATGG - Exonic
1057835646 9:98442771-98442793 ATTGCCAGCCAACCACCAGAAGG - Intronic
1058737991 9:107913267-107913289 TCTTCCCTAGAACCACAAGAAGG - Intergenic
1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG + Intronic
1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG + Intergenic
1186151897 X:6683501-6683523 TTTGCATTAAAACCACAAGGGGG - Intergenic
1188556517 X:31418252-31418274 TTTGCCATGAGAACACAAGAAGG - Intronic
1192552026 X:72062192-72062214 TCTGCCTTACAACCAGATGATGG - Intergenic
1195005524 X:100681632-100681654 GTTGCCATACAAACTCACGAAGG + Intronic
1195944117 X:110190970-110190992 TTAGCTCTACAACAACAAGAAGG - Intergenic
1197160946 X:123321250-123321272 TTTGCCATAAAGCCCCAAAAAGG - Intronic